The peroxidase database
Entry information :
Entry ID 10110
Creation 2012-01-06 (Christophe Dunand)
Last sequence changes 2012-01-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information
Name AacuCP
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus External Link
Organism Aspergillus aculeatus    [TaxId: 5053]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AacuCP
start..stop
S start..stop
AnCP01 1253 0 1..759 1..762
AcarCP 1233 0 1..750 1..752
AorCP01 1212 0 5..749 4..750
AflCP01 1212 0 5..749 4..750
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 29200..31479 2280  
complement(join(29200..31479))


exon

Literature and cross-references
Literature
DNA ref. JGI genome: scaffold_21 (31479..29200)
Cluster/Prediction ref. JGI gene: 36796
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid759
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
83918.04
PI (ph)%sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
6.31
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGESKCPYKAQANVAGGGTRNTDWWPEQLKLNILRQHTSTTNPLKADFDYAAAFQSLDYFALKKDLHALMTDSQDWWPADFGHYGGLFIRMAWHSAGTYRVFDGRGGGGQGQQRFAPLNSWPDNVSLDKARRLLWPIKQKYGDKISWADLLLLTGNVALESMGFKTFGFSGGRPDTFEADESVYWGGETTWLGNDVRYSDGKPGVAAEGVVDSDQSPHRDIHKRDLEKPLASAHMGLIYVNPEGPDGNPDPVAAARDIRVTFSRMGMNDEETVALIAGGHSFGKTHGAAPSSNVEAEPEGAGLESQGLGWKNNHQSGKGPDTITSGLEVIWTKTPTKWSNDYLEYLFRYDWELTKSPAGAHQYVAKDSEAIIPDAYDSSKRHRPTMLTTDLSLRYDPTYEKISRRFLENPDQLADAFSRAWFKLLHRDMGPRTRYIGPEVPTEELIWQDPIPAVNHPLIDANDIASLKRTILEKSGVDRSKLVSTAWASASTFRASDKRGGANGARIRLQPQRDWEVNRQPGLQETLTALESIQKEFNGSASNGKKVSLADLIVLAGSAAVEQAAREAGHNIQVPFIPGRADASQEQTDVESFSHLEPVADGFRNYGRSTPRVRTEQFLVDRAHLLSLSAPELAVLVGGLRVLNANYDGSSHGVFTSRPGQLTNDFFVNLLDMSTDWKATDASRELYEGTDRKTGQRKWTATRADLVFGSHAELRAIAEVYGSVDGPARFVKDFVAAWDKVMNLDRFDLKKQTIVSSRL*


Retrieve as FASTA  
Remarks Complete sequence from genomic (no intron).
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGAGTCCAAGTGTCCCTACAAGGCCCAGGCCAATGTGGCCGGCGGGGGCACGCGTAACACCGACTGGTGGCCCGAGCAGCTGAAGCTCAACATCCTCCGCCAGCACACCTCCACC
ACCAACCCATTGAAGGCCGACTTTGATTATGCTGCTGCCTTCCAGAGCCTGGATTACTTCGCTCTCAAGAAAGACCTCCATGCCCTGATGACCGACTCCCAGGACTGGTGGCCTGCCGAC
TTCGGCCACTACGGGGGTCTCTTCATCCGCATGGCCTGGCACAGTGCTGGCACTTATCGGGTCTTTGACGGCCGTGGCGGTGGAGGGCAGGGTCAGCAGCGGTTTGCCCCCCTCAACAGC
TGGCCCGACAACGTGAGTCTAGACAAGGCTCGTCGGCTCCTGTGGCCGATCAAGCAGAAGTACGGCGACAAGATCTCCTGGGCCGATTTGCTGCTGCTGACGGGCAATGTGGCCCTCGAG
TCCATGGGCTTCAAGACCTTTGGGTTCTCGGGTGGCCGCCCGGACACCTTCGAGGCCGATGAGTCGGTCTATTGGGGTGGGGAGACAACCTGGCTGGGCAACGATGTCCGGTACTCCGAT
GGCAAGCCCGGTGTGGCGGCGGAGGGAGTGGTCGACAGCGATCAATCCCCCCACCGCGACATTCACAAGCGAGACCTGGAGAAGCCCTTGGCGTCGGCGCACATGGGTCTCATCTATGTC
AACCCCGAAGGTCCGGATGGCAATCCCGACCCCGTGGCTGCGGCTCGGGACATCCGCGTCACCTTCAGTCGCATGGGAATGAACGACGAAGAGACGGTCGCCCTCATCGCTGGCGGCCAC
AGCTTCGGCAAGACCCACGGGGCTGCCCCGTCCAGCAATGTAGAGGCAGAGCCTGAAGGCGCGGGCCTTGAGTCGCAGGGACTCGGCTGGAAGAACAACCACCAGTCCGGCAAAGGCCCC
GACACCATCACCAGTGGCCTGGAGGTGATCTGGACCAAGACTCCCACCAAGTGGAGCAACGACTACCTGGAGTATCTGTTCCGCTATGACTGGGAGCTCACCAAGAGTCCCGCAGGGGCT
CACCAGTATGTGGCCAAGGACTCCGAGGCCATTATCCCGGACGCCTACGATTCCTCCAAGCGCCACCGGCCGACTATGCTCACCACCGATCTCTCCCTCCGCTATGACCCTACCTACGAG
AAGATCTCGCGTCGTTTCCTCGAGAACCCCGATCAGCTGGCCGATGCCTTCTCCCGCGCCTGGTTCAAGCTTCTCCACCGCGACATGGGCCCCCGCACTCGGTACATCGGACCTGAGGTC
CCCACCGAGGAGTTGATCTGGCAGGATCCCATCCCTGCCGTCAACCATCCTCTCATTGATGCCAACGATATCGCCTCCCTCAAGCGCACCATCCTGGAGAAGAGTGGCGTCGACCGGTCG
AAGCTGGTGTCGACGGCGTGGGCGTCCGCCTCGACCTTCCGGGCCAGCGACAAGCGCGGCGGTGCCAACGGCGCCCGCATTCGCCTGCAGCCCCAGCGGGATTGGGAGGTGAACCGTCAG
CCCGGGTTGCAGGAGACCCTGACCGCTCTAGAATCCATTCAGAAGGAGTTCAACGGCTCTGCTTCCAACGGAAAGAAGGTCTCCCTGGCCGATCTGATCGTGCTGGCTGGCAGTGCGGCT
GTCGAGCAGGCGGCTCGTGAGGCTGGCCACAACATCCAAGTCCCCTTCATCCCCGGTCGGGCGGATGCCTCGCAGGAGCAGACTGACGTCGAATCTTTCAGTCATCTGGAGCCGGTGGCC
GATGGCTTTCGCAACTACGGTCGCTCGACCCCTCGCGTGCGCACGGAGCAGTTCCTCGTGGACAGGGCTCATCTCCTCAGTCTGTCTGCGCCGGAACTGGCCGTCCTGGTCGGGGGTCTG
CGCGTGCTGAACGCGAACTACGATGGATCGTCTCACGGGGTCTTCACCTCCCGACCGGGGCAGTTGACGAACGACTTCTTCGTCAATCTGTTGGATATGAGCACGGACTGGAAGGCGACC
GATGCCAGTCGGGAATTGTACGAGGGCACAGACCGTAAGACCGGCCAGCGCAAGTGGACGGCCACGCGCGCGGACCTGGTCTTCGGCTCGCATGCCGAGCTGCGGGCGATCGCCGAAGTT
TATGGGAGTGTCGATGGTCCAGCTCGATTTGTCAAGGACTTTGTGGCCGCTTGGGACAAGGTCATGAACCTGGATCGGTTTGACCTCAAGAAGCAGACGATTGTGTCCTCTCGATTGTAG

Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGAGTCCAAGTGTCCCTACAAGGCCCAGGCCAATGTGGCCGGCGGGGGCACGCGTAACACCGACTGGTGGCCCGAGCAGCTGAAGCTCAACATCCTCCGCCAGCACACCTCCACC
ACCAACCCATTGAAGGCCGACTTTGATTATGCTGCTGCCTTCCAGAGCCTGGATTACTTCGCTCTCAAGAAAGACCTCCATGCCCTGATGACCGACTCCCAGGACTGGTGGCCTGCCGAC
TTCGGCCACTACGGGGGTCTCTTCATCCGCATGGCCTGGCACAGTGCTGGCACTTATCGGGTCTTTGACGGCCGTGGCGGTGGAGGGCAGGGTCAGCAGCGGTTTGCCCCCCTCAACAGC
TGGCCCGACAACGTGAGTCTAGACAAGGCTCGTCGGCTCCTGTGGCCGATCAAGCAGAAGTACGGCGACAAGATCTCCTGGGCCGATTTGCTGCTGCTGACGGGCAATGTGGCCCTCGAG
TCCATGGGCTTCAAGACCTTTGGGTTCTCGGGTGGCCGCCCGGACACCTTCGAGGCCGATGAGTCGGTCTATTGGGGTGGGGAGACAACCTGGCTGGGCAACGATGTCCGGTACTCCGAT
GGCAAGCCCGGTGTGGCGGCGGAGGGAGTGGTCGACAGCGATCAATCCCCCCACCGCGACATTCACAAGCGAGACCTGGAGAAGCCCTTGGCGTCGGCGCACATGGGTCTCATCTATGTC
AACCCCGAAGGTCCGGATGGCAATCCCGACCCCGTGGCTGCGGCTCGGGACATCCGCGTCACCTTCAGTCGCATGGGAATGAACGACGAAGAGACGGTCGCCCTCATCGCTGGCGGCCAC
AGCTTCGGCAAGACCCACGGGGCTGCCCCGTCCAGCAATGTAGAGGCAGAGCCTGAAGGCGCGGGCCTTGAGTCGCAGGGACTCGGCTGGAAGAACAACCACCAGTCCGGCAAAGGCCCC
GACACCATCACCAGTGGCCTGGAGGTGATCTGGACCAAGACTCCCACCAAGTGGAGCAACGACTACCTGGAGTATCTGTTCCGCTATGACTGGGAGCTCACCAAGAGTCCCGCAGGGGCT
CACCAGTATGTGGCCAAGGACTCCGAGGCCATTATCCCGGACGCCTACGATTCCTCCAAGCGCCACCGGCCGACTATGCTCACCACCGATCTCTCCCTCCGCTATGACCCTACCTACGAG
AAGATCTCGCGTCGTTTCCTCGAGAACCCCGATCAGCTGGCCGATGCCTTCTCCCGCGCCTGGTTCAAGCTTCTCCACCGCGACATGGGCCCCCGCACTCGGTACATCGGACCTGAGGTC
CCCACCGAGGAGTTGATCTGGCAGGATCCCATCCCTGCCGTCAACCATCCTCTCATTGATGCCAACGATATCGCCTCCCTCAAGCGCACCATCCTGGAGAAGAGTGGCGTCGACCGGTCG
AAGCTGGTGTCGACGGCGTGGGCGTCCGCCTCGACCTTCCGGGCCAGCGACAAGCGCGGCGGTGCCAACGGCGCCCGCATTCGCCTGCAGCCCCAGCGGGATTGGGAGGTGAACCGTCAG
CCCGGGTTGCAGGAGACCCTGACCGCTCTAGAATCCATTCAGAAGGAGTTCAACGGCTCTGCTTCCAACGGAAAGAAGGTCTCCCTGGCCGATCTGATCGTGCTGGCTGGCAGTGCGGCT
GTCGAGCAGGCGGCTCGTGAGGCTGGCCACAACATCCAAGTCCCCTTCATCCCCGGTCGGGCGGATGCCTCGCAGGAGCAGACTGACGTCGAATCTTTCAGTCATCTGGAGCCGGTGGCC
GATGGCTTTCGCAACTACGGTCGCTCGACCCCTCGCGTGCGCACGGAGCAGTTCCTCGTGGACAGGGCTCATCTCCTCAGTCTGTCTGCGCCGGAACTGGCCGTCCTGGTCGGGGGTCTG
CGCGTGCTGAACGCGAACTACGATGGATCGTCTCACGGGGTCTTCACCTCCCGACCGGGGCAGTTGACGAACGACTTCTTCGTCAATCTGTTGGATATGAGCACGGACTGGAAGGCGACC
GATGCCAGTCGGGAATTGTACGAGGGCACAGACCGTAAGACCGGCCAGCGCAAGTGGACGGCCACGCGCGCGGACCTGGTCTTCGGCTCGCATGCCGAGCTGCGGGCGATCGCCGAAGTT
TATGGGAGTGTCGATGGTCCAGCTCGATTTGTCAAGGACTTTGTGGCCGCTTGGGACAAGGTCATGAACCTGGATCGGTTTGACCTCAAGAAGCAGACGATTGTGTCCTCTCGATTGTAG
Retrieve as FASTA  
 

<< Back