The peroxidase database
Entry information :
Entry ID 10124
Creation 2012-01-09 (Christophe Dunand)
Last sequence changes 2012-01-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information
Name AacuDyPrx
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus External Link
Organism Aspergillus aculeatus    [TaxId: 5053]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AacuDyPrx
start..stop
S start..stop
NfDyPrx02 932 0 7..542 10..544
AclDyPrx02 915 0 7..542 10..544
AcarDyPrx02 870 0 7..542 10..545
AorDyPrx02 862 0 7..541 10..541
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2031569..2031868 300 N° 2 2031948..2032333 386 N° 3 2032400..2032707 308 N° 4 2032769..2033149 381
N° 5 2033209..2033462 254  
join(2031569..2031868,2031948..2032333,2032400..2032707,2032769..2033149,2033209 ..2033462)


exon

Literature and cross-references
Literature
DNA ref. JGI genome: scaffold_5 (2031569..2033462)
Cluster/Prediction ref. JGI gene: 42087
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid543
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
61501.69
PI (ph)%sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
5.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRAPEKVNTDNIQGSIWPRLPKHFESYLFFKITDKGKFRKHLRTLLDNNEITTGTQCADHLRGVGEFEEASAQARRDVPEPYRVPFTAVNVAFTHLGLLKVERPEVEVEFAKVQQEDPDEYCRDRINEGLFEKGMFDDLVYEGADSPPALHPDFRAPEANLAKEDPLQRWDWRVDGVFIVAAHSAKALRRKIVDVEDAFYVGDANENSMKIAFRRDGQTRPGANRGKEHFGYEDHISQPKIRGLDPAPAPGEPHACPPGYIFLGFEGDPNKKRGPAWAKEGSFLVFRQLDQKVPEFEKFLEEKASQIPGTNYAGPNGPAKLGAHLMGRWKGAPVAHAYDEDKPELAFNNTFDFRPKKSIKSCPFAAHIRKMRPRSDKKRDVGTEEDGDETALPEPDSDEEEAEGQEEDASVILRRGITFGPELTEEEKRLRKTIEHRGIYFTCYQSLIRDGFNFLMTRWASNASFPEYKTKTFPDGPGMDPFVNQRLRKDHPEGHISLYDGENPDKTVKLNLGISPWVDQRGGEYFFTPSLSALREHFSTA


Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTGCCCCAGAGAAGGTCAACACTGACAACATTCAGGGGAGCATCTGGCCCCGGCTGCCCAAGCACTTTGAATCCTACTTGTTTTTCAAAATCACCGACAAGGGCAAGTTCCGCAAA
CACCTGCGGACCCTGCTGGACAACAATGAAATCACCACCGGCACGCAATGCGCGGATCACCTCCGTGGAGTGGGAGAGTTCGAAGAGGCTTCCGCGCAAGCCCGACGTGATGTCCCCGAG
CCCTATCGGGTGCCCTTCACCGCGGTGAATGTGGCCTTCACCCATCTGGGTCTGCTGAAG
GTTGGTAATGGCCTCGAACCCCCCCTTTGCTCTCTGTTCTTTCCTTCCGGACTCTAACGC
CCGGCTTTACGTGTTGTAGGTCGAAAGGCCCGAGGTGGAGGTCGAGTTTGCCAAAGTCCAACAGGAAGACCCCGACGAGTATTGCCGGGACCGAATAAATGAGGGTCTTTTCGAAAAGGG
CATGTTCGATGATTTGGTCTACGAGGGCGCCGATAGCCCCCCTGCGCTGCATCCGGACTTTCGGGCCCCGGAGGCTAATCTGGCCAAGGAAGACCCTCTGCAACGGTGGGACTGGCGTGT
CGATGGTGTCTTCATCGTGGCGGCGCACAGTGCCAAGGCTCTCCGCCGGAAGATCGTGGACGTCGAGGATGCCTTCTACGTGGGCGATGCAAACGAGAACAGTATGAAGATCGCCTTTCG
ACGCGATGGTCAAACCCGACCGGGGGCAAACCGGGGCAAGGAACA
GTACGTGTGTTCTAGGGAAACCTCAATTACATGACCATCATAGACTAACGTACCTCCTCGTTGCAGCTTTGGCTA
CGAAGACCACATCTCGCAGCCCAAGATCCGAGGGCTGGATCCGGCCCCTGCCCCGGGCGAGCCTCATGCCTGTCCTCCGGGGTACATCTTCCTTGGGTTTGAGGGGGATCCCAACAAGAA
GCGAGGCCCGGCCTGGGCCAAGGAGGGCAGTTTTCTGGTTTTCCGGCAGTTGGACCAGAAGGTCCCCGAGTTTGAGAAGTTCCTTGAGGAGAAGGCTTCTCAGATCCCGGGCACCAACTA
TGCGGGGCCCAATGGTCCGGCCAAGCTGGGAGCTCACTTGATGGGTCGCTGGAAGAGTG
GTACGAATCCGGCGAATCTCGATTTCTTCTCTCTTTACAAACGCAGACTGATCAAGCATAG

GCGCTCCCGTGGCGCACGCTTACGACGAGGATAAGCCCGAGTTGGCCTTCAACAACACGTTCGACTTCCGACCCAAGAAGAGCATCAAGAGCTGTCCATTCGCAGCGCACATCCGCAAGA
TGCGCCCTCGATCCGATAAGAAACGCGACGTGGGGACCGAAGAAGACGGGGACGAGACCGCACTGCCCGAGCCCGACAGCGATGAAGAAGAGGCCGAGGGACAAGAAGAGGATGCCAGCG
TCATTCTTCGACGAGGCATTACATTTGGTCCGGAACTGACTGAAGAGGAGAAGCGGCTGCGGAAGACCATCGAGCACCGGGGCATTTACTTTACCTGCTATCAGAGCCTGATCCGGGATG
GATTCAATTTCCTTATGACTC
GTACGTTGGTTGATATTAGGGCTAAGATAGAAGAACTACGCAATGCTGACACGAGCCAGGCTGGGCGAGTAACGCCTCCTTCCCCGAGTACAAGACCAA
GACCTTCCCCGATGGGCCGGGCATGGACCCCTTTGTCAACCAGAGGCTTCGCAAGGATCATCCCGAGGGCCACATCAGTCTGTATGATGGAGAAAACCCCGACAAGACGGTGAAATTGAA
TCTGGGCATTAGCCCCTGGGTGGACCAAAGGGGTGGTGAGTATTTCTTTACTCCTTCGCTCAGCGCGTTGAGGGAGCACTTTTCGACGGCTTGA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTGCCCCAGAGAAGGTCAACACTGACAACATTCAGGGGAGCATCTGGCCCCGGCTGCCCAAGCACTTTGAATCCTACTTGTTTTTCAAAATCACCGACAAGGGCAAGTTCCGCAAA
CACCTGCGGACCCTGCTGGACAACAATGAAATCACCACCGGCACGCAATGCGCGGATCACCTCCGTGGAGTGGGAGAGTTCGAAGAGGCTTCCGCGCAAGCCCGACGTGATGTCCCCGAG
CCCTATCGGGTGCCCTTCACCGCGGTGAATGTGGCCTTCACCCATCTGGGTCTGCTGAAG
GTCGAAAGGCCCGAGGTGGAGGTCGAGTTTGCCAAAGTCCAACAGGAAGACCCCGACGAG
TATTGCCGGGACCGAATAAATGAGGGTCTTTTCGAAAAGGGCATGTTCGATGATTTGGTCTACGAGGGCGCCGATAGCCCCCCTGCGCTGCATCCGGACTTTCGGGCCCCGGAGGCTAAT
CTGGCCAAGGAAGACCCTCTGCAACGGTGGGACTGGCGTGTCGATGGTGTCTTCATCGTGGCGGCGCACAGTGCCAAGGCTCTCCGCCGGAAGATCGTGGACGTCGAGGATGCCTTCTAC
GTGGGCGATGCAAACGAGAACAGTATGAAGATCGCCTTTCGACGCGATGGTCAAACCCGACCGGGGGCAAACCGGGGCAAGGAACA
CTTTGGCTACGAAGACCACATCTCGCAGCCCAAG
ATCCGAGGGCTGGATCCGGCCCCTGCCCCGGGCGAGCCTCATGCCTGTCCTCCGGGGTACATCTTCCTTGGGTTTGAGGGGGATCCCAACAAGAAGCGAGGCCCGGCCTGGGCCAAGGAG
GGCAGTTTTCTGGTTTTCCGGCAGTTGGACCAGAAGGTCCCCGAGTTTGAGAAGTTCCTTGAGGAGAAGGCTTCTCAGATCCCGGGCACCAACTATGCGGGGCCCAATGGTCCGGCCAAG
CTGGGAGCTCACTTGATGGGTCGCTGGAAGAGTG
GCGCTCCCGTGGCGCACGCTTACGACGAGGATAAGCCCGAGTTGGCCTTCAACAACACGTTCGACTTCCGACCCAAGAAGAGCATC
AAGAGCTGTCCATTCGCAGCGCACATCCGCAAGATGCGCCCTCGATCCGATAAGAAACGCGACGTGGGGACCGAAGAAGACGGGGACGAGACCGCACTGCCCGAGCCCGACAGCGATGAA
GAAGAGGCCGAGGGACAAGAAGAGGATGCCAGCGTCATTCTTCGACGAGGCATTACATTTGGTCCGGAACTGACTGAAGAGGAGAAGCGGCTGCGGAAGACCATCGAGCACCGGGGCATT
TACTTTACCTGCTATCAGAGCCTGATCCGGGATGGATTCAATTTCCTTATGACTC
GCTGGGCGAGTAACGCCTCCTTCCCCGAGTACAAGACCAAGACCTTCCCCGATGGGCCGGGCATG
GACCCCTTTGTCAACCAGAGGCTTCGCAAGGATCATCCCGAGGGCCACATCAGTCTGTATGATGGAGAAAACCCCGACAAGACGGTGAAATTGAATCTGGGCATTAGCCCCTGGGTGGAC
CAAAGGGGTGGTGAGTATTTCTTTACTCCTTCGCTCAGCGCGTTGAGGGAGCACTTTTCGACGGCTTGA
Retrieve as FASTA  
 

<< Back