The peroxidase database
Entry information :
Entry ID 10717
Creation 2012-03-08 (Christophe Dunand)
Last sequence changes 2012-03-08 (Christophe Dunand)
Sequence status complete
Reviewer Bruno Savelli
Last annotation changes 2015-12-16 (Bruno Savelli)
Peroxidase information
Name AalcAPx-CcP
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Acremonium External Link
Organism Acremonium alcalophilum    [TaxId: 398408]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AalcAPx-CcP
start..stop
S start..stop
VdaAPx-CcP01 1280 0 18..1037 15..1001
CgraAPx-CcP 1164 0 20..1040 20..1062
StheAPx-CcP01 1066 0 1..1044 1..1056
CtheAPx-CcP01 1053 0 1..1038 1..1023
CtheAPx-CcP01 297 9e-86 694..1042 575..905
VdaAPx-CcP01 247 3e-68 574..927 674..1004
VdaAPx-CcP01 229 2e-62 691..1046 557..901
CgraAPx-CcP 94 7e-20 949..1042 866..958
CtheAPx-CcP01 94 1e-19 592..678 941..1027
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3588511..3590183 1673 N° 2 3590283..3590863 581 N° 3 3590982..3591874 893  
join(3588511..3590183,3590283..3590863,3590982..3591874)


exon

Literature and cross-references
Literature
DNA ref. JGI genome: scaffold_1 (3588511..3591874)
Cluster/Prediction ref. JGI gene: 2095766
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid 1049 (1028)
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
111688.02 (109580.8)
PI (pH) %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
4.24 (4.21) Peptide Signal %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 21 range:21-1048
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRINGLALLALLGVVTRTGADPTWPSSIDEVEEIMFQIASTRSRKFADSVNPCTSQASGPGRHSAAEWLRTAFHDMATAHVFQGLGGLDASLQYELSNGENAGPGFATTLTWMAPYLSRRSSMADLIALGVYTSVRACGGPAVPIRAGRVDAVQGGSPGVPQPQNAIGIFRNQFQRMGFTSEEMVQLTACGHTLGGVHSSQFPDIVPPGTRPNDHAPFDSTVAVFDDRIVTDYLNGTTQNPLVVGPAVRINKHSDFKLFNSDANATISAMAGASTFREICRTVLQKMIDTVPPGVTLGEPITPYQVKPVQLQLTLSPQLGALDFTGYIRVRTTEMPLDTIEGLTINYRNRNGGSECGSGPCSFSLSVQGVGRGFDDTFAWFPIARQLPVSSGISSFTVTIRRTDGTSLLVDNNGNGYPLQDGVFLQRYQSCILATSGTTTLSAAVRNDRADLPVKAVISYKTPQTGSVVPALNNMTLELTKGPCVGSYTLFSASTTIPGGLSVEADFDIISGEGSSALVDYFKKANILGGACQSFPQTGSCTTPSSTSSSSETPASTDSIESNTASSTTSSTVPTESPHHREVIGEYRLVSCWTEGDGVRALSGASFAYDSMTLESCMANCTGFDYWGTEYGRECYCGNSLHGSTSSAPLDECDMACGGDDTQYCGSGNRLELYSTTATRSSSATSSAPTPTETPVRLPMVSDYAHVGCQTEGVGVRALQGPVLVDDDMTLDMCADFCSNYVYFGTEYGRCYCGNSLHSSSEPAPLEECGMTCAGNPFQYCGAGNRIELYRANTPSMVVPTPTDSSSWASTSSTQESSTTTMTEANPSHRPTVTPYMLVGCQTEGTGARALDGPSYASGTEMTLEACAEFCEGYRYFGTQYSAECFCGNRLHDTSLPAPLSECPMLCSGNPSEYCGGPDRLTLYRNDDIPSEEPDPEPRQPAFAGDDFVWLGCWTEPVAAGARALDGPTTASDDMSNEVCAEFCDGFAYFGTEYGRECFCGDEIHEGSEELDEEECNMRCSGARDEFCGNSNRLSVYARDEDADTES


Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). Peroxidase domain fused to 4 WSC domains (putative carbohydrate binding domain)
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGATCAATGGGCTTGCACTGTTGGCGCTGCTGGGTGTGGTCACCCGGACAGGCGCCGACCCGACCTGGCCTTCAAGCATCGACGAGGTAGAAGAGATCATGTTCCAGATCGCGAGC
ACCCGCTCCCGTAAGTTTGCCGACTCGGTGAACCCCTGCACCAGCCAGGCCTCTGGGCCCGGTCGACACAGCGCCGCCGAGTGGCTTCGAACCGCCTTCCATGACATGGCGACAGCCCAC
GTTTTCCAGGGACTAGGCGGCTTGGATGCGTCCTTGCAGTACGAATTAAGCAATGGCGAGAACGCGGGCCCGGGCTTTGCCACCACTCTGACGTGGATGGCTCCGTATTTGTCGAGGAGG
AGCTCCATGGCAGACCTCATCGCCTTGGGCGTCTACACATCCGTCCGCGCCTGCGGTGGTCCCGCCGTGCCCATTCGTGCCGGCCGCGTCGATGCCGTGCAGGGCGGCAGTCCGGGCGTC
CCGCAACCCCAGAACGCCATTGGCATTTTCCGTAACCAGTTTCAGCGTATGGGATTCACAAGCGAGGAGATGGTTCAGTTGACCGCGTGTGGCCATACCCTCGGCGGCGTCCATTCCTCC
CAGTTCCCGGACATTGTGCCTCCGGGCACGAGGCCCAACGACCACGCCCCTTTTGACTCGACCGTAGCCGTCTTTGACGACAGGATTGTCACCGACTACCTGAACGGCACGACGCAGAAT
CCCCTCGTCGTGGGTCCAGCAGTCCGCATCAACAAGCACTCCGACTTCAAGTTGTTCAACTCGGACGCCAATGCAACTATATCGGCCATGGCTGGTGCGTCCACCTTTCGCGAGATATGT
AGAACCGTCCTGCAGAAGATGATCGACACCGTCCCCCCAGGCGTCACCCTGGGCGAGCCCATCACCCCGTATCAGGTGAAACCCGTCCAGCTACAGCTCACGCTCTCTCCGCAACTCGGT
GCCTTGGACTTCACCGGCTACATCCGCGTTCGGACCACCGAAATGCCCCTCGACACGATCGAGGGGTTGACCATCAACTACAGGAACCGAAACGGAGGGTCCGAGTGCGGGTCAGGACCT
TGCAGCTTCTCCCTGTCGGTCCAGGGCGTTGGTAGAGGCTTCGACGACACCTTTGCCTGGTTCCCAATCGCGCGGCAGCTGCCCGTCTCCTCAGGTATCTCGTCCTTCACCGTCACCATT
CGCAGGACAGACGGGACCAGCCTCCTCGTGGATAACAACGGCAACGGCTATCCCTTGCAAGACGGCGTCTTCCTCCAACGGTATCAGAGCTGTATCCTGGCCACCTCCGGAACGACTACC
CTGAGCGCCGCCGTCCGGAACGACCGTGCGGATCTTCCCGTCAAGGCCGTCATCTCGTACAAGACCCCGCAGACGGGGAGCGTCGTGCCGGCTCTGAACAACATGACGCTGGAGCTAACC
AAGGGGCCCTGCGTCGGCAGCTATACTCTATTCTCGGCGAGCACCACGATCCCGGGAGGCCTCAGCGTTGAAGCAGATTTCGACATCATCAGCGGAGAGGGCTCGTCAGCTCTGGTGGAT
TATTTCAAGAAGGCCAACATCCTTGGGGGTGCGTGCCAGTCGTTCCCACAGACGGGATCATGCACGACTCCCTCGTCGACGTCATCGTCTTCGGAGACCCCGGCCAGCACCGA
GTCGTCG
TCCATCGTGTCGCGCGATATCAGCACTTCATCTGAGCTGCCGGCTTCGTCTGAGCCACCCAGTTCGGAGCCAACTTCGGCGCTGCCATCGAGCTCTATTGAATCCAACACGGCGTCTTCG
ACGACATCCAGCACGGTTCCGACAGAATCGCCCCACCACAGGGAGGTCATAGGCGAGTACAGGCTTGTCTCCTGCTGGACCGAGGGCGACGGGGTCCGCGCCCTCAGCGGTGCGAGCTTC
GCCTATGACTCGATGACCTTGGAGAGCTGCATGGCCAACTGCACCGGGTTTGACTATTGGGGTACCGAGTACGGCCGGGAATGCTACTGCGGCAACTCTCTTCACGGGTCCACATCATCT
GCGCCTCTTGACGAATGTGACATGGCTTGCGGCGGAGACGACACCCAGTATTGTGGCTCTGGTAACAGGCTGGAGCTCTACTCCACGACAGCAACCCGTAGCAGCAGCGCCACGAGCTCT
GCTCCGACTCCCACCGAAACACCGGTCCGCCTGCCGATGGTGTCCGACTATGCTCACGTCGGTTGCCAGACTGAGGGCGTCGGGGTTCGAGCTCTCCAGGGGCCGGTCCTAGTGGACGAT
GACATGACGCTCGATATGTGTGCCGACTTCTGCTCAAATTATGTTTACTTTGGAACCGAATACGGCCGAGAGT
GTTAGTGATGCCCAGCTCTCCTTCTGGCCTTCGTTTCCTTTTCCCCT
TTCGTTCTTTTCTCCCCTTATCCCAGGTAAAAGGAACTTGACACGTAAAGGTCCCGGCTAACCATGTGAAGGCTATTGTGGCAACTCCCTCCATTCATCTAGCGAGCCCGCACCGTTAGA
AGAGTGCGGAATGACATGCGCCGGAAACCCATTCCAATACTGCGGCGCCGGCAACCGAATCGAGCTGTACCGGGCGAACACCCCCTCCATGGTCGTACCCACGCCCACAGACAGCTCGTC
TTGGGCATCCACAAGTAGCACACAAGAGTCGTCGACGACAACCATGACAGAGGCAAACCCCTCCCACCGGCCCACCGTCACTCCGTACATGCTCGTCGGCTGCCAGACGGAAGGTACCGG
TGCCCGTGCCCTCGACGGCCCCTCATACGCCTCAGGCACGGAGATGACGCTGGAGGCCTGCGCCGAGTTCTGCGAAGGATACCGTTACTTCGGCACGCAATACAGCGCCGAGTGTTTCTG
CGGGAACAGGCTGCACGACACCTCGCTCCCAGCCCCGCTCTCCGAATGTCCCATGCTCTGCTCCGGCAACCCGTCCGAGTACTGCGGCGGACCGGACCGCCTCACGCTATACCGCAACGA
CGACATCCCTTCGGAGGAGCCCGACCCGGAACCACGCCAGCCGGCTTTCGCGGGCGACGACTTTGTCTGGCTGGGATGCTGGACAGAGCCGGTAGCAGCGGGCGCGCGGGCGTTGGACGG
GCCGACGACGGCGTCGGACGACATGTCCAACGAGGTTTGCGCAGAGTTTTGTGACGGGTTTGCGTACTTTGGTACCGAGTACGGCCGGGAGTGTTTCTGCGGCGACGAGATCCATGAGGG
ATCCGAGGAGTTGGATGAGGAGGAGTGCAATATGCGGTGCTCTGGCGCGAGGGACGAATTCTGTGGCAACTCGAATCGGCTTTCGGTATATGCACGAGATGAGGACGCGGATACGGAATC
GTAG
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGATCAATGGGCTTGCACTGTTGGCGCTGCTGGGTGTGGTCACCCGGACAGGCGCCGACCCGACCTGGCCTTCAAGCATCGACGAGGTAGAAGAGATCATGTTCCAGATCGCGAGC
ACCCGCTCCCGTAAGTTTGCCGACTCGGTGAACCCCTGCACCAGCCAGGCCTCTGGGCCCGGTCGACACAGCGCCGCCGAGTGGCTTCGAACCGCCTTCCATGACATGGCGACAGCCCAC
GTTTTCCAGGGACTAGGCGGCTTGGATGCGTCCTTGCAGTACGAATTAAGCAATGGCGAGAACGCGGGCCCGGGCTTTGCCACCACTCTGACGTGGATGGCTCCGTATTTGTCGAGGAGG
AGCTCCATGGCAGACCTCATCGCCTTGGGCGTCTACACATCCGTCCGCGCCTGCGGTGGTCCCGCCGTGCCCATTCGTGCCGGCCGCGTCGATGCCGTGCAGGGCGGCAGTCCGGGCGTC
CCGCAACCCCAGAACGCCATTGGCATTTTCCGTAACCAGTTTCAGCGTATGGGATTCACAAGCGAGGAGATGGTTCAGTTGACCGCGTGTGGCCATACCCTCGGCGGCGTCCATTCCTCC
CAGTTCCCGGACATTGTGCCTCCGGGCACGAGGCCCAACGACCACGCCCCTTTTGACTCGACCGTAGCCGTCTTTGACGACAGGATTGTCACCGACTACCTGAACGGCACGACGCAGAAT
CCCCTCGTCGTGGGTCCAGCAGTCCGCATCAACAAGCACTCCGACTTCAAGTTGTTCAACTCGGACGCCAATGCAACTATATCGGCCATGGCTGGTGCGTCCACCTTTCGCGAGATATGT
AGAACCGTCCTGCAGAAGATGATCGACACCGTCCCCCCAGGCGTCACCCTGGGCGAGCCCATCACCCCGTATCAGGTGAAACCCGTCCAGCTACAGCTCACGCTCTCTCCGCAACTCGGT
GCCTTGGACTTCACCGGCTACATCCGCGTTCGGACCACCGAAATGCCCCTCGACACGATCGAGGGGTTGACCATCAACTACAGGAACCGAAACGGAGGGTCCGAGTGCGGGTCAGGACCT
TGCAGCTTCTCCCTGTCGGTCCAGGGCGTTGGTAGAGGCTTCGACGACACCTTTGCCTGGTTCCCAATCGCGCGGCAGCTGCCCGTCTCCTCAGGTATCTCGTCCTTCACCGTCACCATT
CGCAGGACAGACGGGACCAGCCTCCTCGTGGATAACAACGGCAACGGCTATCCCTTGCAAGACGGCGTCTTCCTCCAACGGTATCAGAGCTGTATCCTGGCCACCTCCGGAACGACTACC
CTGAGCGCCGCCGTCCGGAACGACCGTGCGGATCTTCCCGTCAAGGCCGTCATCTCGTACAAGACCCCGCAGACGGGGAGCGTCGTGCCGGCTCTGAACAACATGACGCTGGAGCTAACC
AAGGGGCCCTGCGTCGGCAGCTATACTCTATTCTCGGCGAGCACCACGATCCCGGGAGGCCTCAGCGTTGAAGCAGATTTCGACATCATCAGCGGAGAGGGCTCGTCAGCTCTGGTGGAT
TATTTCAAGAAGGCCAACATCCTTGGGGGTGCGTGCCAGTCGTTCCCACAGACGGGATCATGCACGACTCCCTCGTCGACGTCATCGTCTTCGGAGACCCCGGCCAGCACCGA
CTCTATT
GAATCCAACACGGCGTCTTCGACGACATCCAGCACGGTTCCGACAGAATCGCCCCACCACAGGGAGGTCATAGGCGAGTACAGGCTTGTCTCCTGCTGGACCGAGGGCGACGGGGTCCGC
GCCCTCAGCGGTGCGAGCTTCGCCTATGACTCGATGACCTTGGAGAGCTGCATGGCCAACTGCACCGGGTTTGACTATTGGGGTACCGAGTACGGCCGGGAATGCTACTGCGGCAACTCT
CTTCACGGGTCCACATCATCTGCGCCTCTTGACGAATGTGACATGGCTTGCGGCGGAGACGACACCCAGTATTGTGGCTCTGGTAACAGGCTGGAGCTCTACTCCACGACAGCAACCCGT
AGCAGCAGCGCCACGAGCTCTGCTCCGACTCCCACCGAAACACCGGTCCGCCTGCCGATGGTGTCCGACTATGCTCACGTCGGTTGCCAGACTGAGGGCGTCGGGGTTCGAGCTCTCCAG
GGGCCGGTCCTAGTGGACGATGACATGACGCTCGATATGTGTGCCGACTTCTGCTCAAATTATGTTTACTTTGGAACCGAATACGGCCGAGAGT
GCTATTGTGGCAACTCCCTCCATTCA
TCTAGCGAGCCCGCACCGTTAGAAGAGTGCGGAATGACATGCGCCGGAAACCCATTCCAATACTGCGGCGCCGGCAACCGAATCGAGCTGTACCGGGCGAACACCCCCTCCATGGTCGTA
CCCACGCCCACAGACAGCTCGTCTTGGGCATCCACAAGTAGCACACAAGAGTCGTCGACGACAACCATGACAGAGGCAAACCCCTCCCACCGGCCCACCGTCACTCCGTACATGCTCGTC
GGCTGCCAGACGGAAGGTACCGGTGCCCGTGCCCTCGACGGCCCCTCATACGCCTCAGGCACGGAGATGACGCTGGAGGCCTGCGCCGAGTTCTGCGAAGGATACCGTTACTTCGGCACG
CAATACAGCGCCGAGTGTTTCTGCGGGAACAGGCTGCACGACACCTCGCTCCCAGCCCCGCTCTCCGAATGTCCCATGCTCTGCTCCGGCAACCCGTCCGAGTACTGCGGCGGACCGGAC
CGCCTCACGCTATACCGCAACGACGACATCCCTTCGGAGGAGCCCGACCCGGAACCACGCCAGCCGGCTTTCGCGGGCGACGACTTTGTCTGGCTGGGATGCTGGACAGAGCCGGTAGCA
GCGGGCGCGCGGGCGTTGGACGGGCCGACGACGGCGTCGGACGACATGTCCAACGAGGTTTGCGCAGAGTTTTGTGACGGGTTTGCGTACTTTGGTACCGAGTACGGCCGGGAGTGTTTC
TGCGGCGACGAGATCCATGAGGGATCCGAGGAGTTGGATGAGGAGGAGTGCAATATGCGGTGCTCTGGCGCGAGGGACGAATTCTGTGGCAACTCGAATCGGCTTTCGGTATATGCACGA
GATGAGGACGCGGATACGGAATCGTAG
Retrieve as FASTA  
 

<< Back