The peroxidase database
Entry information :
Entry ID 10793
Creation 2012-03-01 (Catherine Mathe)
Last sequence changes 2012-03-27 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-03-27 (Christophe Dunand)
Peroxidase information
Name BaDyPrx12
Class DyP-type peroxidase C    [Orthogroup: DyPrxC001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Meruliaceae Bjerkandera External Link
Organism Bjerkandera adusta    [TaxId: 5331]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BaDyPrx12
start..stop
S start..stop
BaDyPrx01 627 0 1..327 1..327
BaDyPrx06 529 0 1..327 1..327
BaDyPrx02 473 3e-167 1..327 1..324
BaDyPrx04 468 1e-165 20..327 1..308
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12573..12684 112 N° 2 12740..12842 103 N° 3 12898..13231 334 N° 4 13278..13392 115
N° 5 13445..13761 317  
join(12573..12684,12740..12842,12898..13231,13278..13392,13445..13761)


exon

Literature and cross-references
Literature
DNA ref. JGI genome: scaffold_45 (12573..13761)
Cluster/Prediction ref. JGI gene: 122578
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid 327 (305)
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
34952.81 (32615.7)
PI (pH) %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
7.73 (7.76) Peptide Signal %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 23 range:23-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHFSLLFASVFAFICASSHVAATSLTERQSRTAPLLGAFPGQAPLPTLAQILGLNATNGTYLPLENIQGDILVGMRKQKERFVFFHVNDATQFKKSLQAYIPARITSCATLISSPNQQPLAFVNLAFSSAGLTALGIKDDLYDARFTSGMFADAQNLGDDLSQWAAPFTGTTIHGVFVIGSDNAFLDQYTSDITSFFGTSLTQVKVMSGSSRPGTNSGHEHFGYLDGISQPAITGWAIDVLPGQAVVPTGVILTGRLGDPMPRPVWAIDGTFMAFRHLQQKVPEFHAYTVANAIRASPAGFLTPQQGAELLGARMFGRWKSGAPL


Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACTTTTCCCTCCTTTTCGCGTCGGTATTCGCGTTCATCTGTGCAAGTAGCCATGTTGCTGCCACCAGCCTCACCGAGAGGCAGTCGCGTACTGCACCGCTGCTTGGTGGTACGTCA
GCTATGCGCCCGTTCAATCAGTCTAGACCTGACCTCATATCGTTCAGCGTTTCCCGGACAAGCTCCCCTGCCTACCCTTGCGCAAATCCTCGGATTGAACGCGACGAACGGGACATACCT
GCCGCTAGAGAACATCCAAGGAGACATATT
GTACGTCGCCTCCTCCCCTCGCGTTCAATCCTGTCGCTAACGCTCGACACTTAAGAGTCGGAATGAGGAAACAAAAAGAACGTTTCGTCT
TTTTCCACGTCAACGACGCGACGCAGTTCAAGAAGTCGCTACAGGCCTATATCCCAGCGCGCATCACATCGTGTGCGACCCTCATTTCATCCCCCAACCAGCAACCGCTCGCGTTCGTCA
ACCTTGCCTTCTCGAGTGCAGGGCTCACTGCGCTTGGGATCAAGGACGACCTCTACGACGCGCGATTCACCTCTGGCATGTTTGCGGACGCGCAAAACCTTGGGGACGATCTCAGCCAAT
GGGCGGCACCTTTTACTGGGACCACTATCCATGGGGTGTTTGTCATAGGGAGCGACCAG
GTGAGTACGATTCGGATGTATTGAGGATCGTACTCATCGATCGTAGAATGCGTTTTTGGAC
CAATACACGAGCGACATTACCTCATTCTTTGGAACCTCCCTCACGCAAGTCAAGGTAATGAGCGGGTCCTCCCGTCCTGGAACCAATTCTGGACACGAGC
GTAAGTCGTTAACACTCTTC
TGCGACAGGTAGCGATCTGACACGCTAGACAGACTTTGGCTACCTCGACGGCATCTCCCAGCCAGCCATCACAGGCTGGGCAATCGACGTCCTCCCAGGTCAAGCCGTCGTGCCCACGGG
GGTCATCCTCACGGGACGTTTGGGCGACCCAATGCCCCGCCCAGTATGGGCCATCGACGGGACCTTCATGGCGTTCCGGCACCTGCAACAGAAAGTGCCCGAGTTTCACGCCTACACGGT
CGCCAACGCCATACGCGCGAGCCCTGCAGGGTTCCTCACACCTCAGCAGGGCGCAGAGCTCCTGGGCGCGCGCATGTTTGGACGTTGGAAGAGCGGTGCACCATTGGAC
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACTTTTCCCTCCTTTTCGCGTCGGTATTCGCGTTCATCTGTGCAAGTAGCCATGTTGCTGCCACCAGCCTCACCGAGAGGCAGTCGCGTACTGCACCGCTGCTTGGTGCGTTTCCC
GGACAAGCTCCCCTGCCTACCCTTGCGCAAATCCTCGGATTGAACGCGACGAACGGGACATACCTGCCGCTAGAGAACATCCAAGGAGACATATT
AGTCGGAATGAGGAAACAAAAAGAA
CGTTTCGTCTTTTTCCACGTCAACGACGCGACGCAGTTCAAGAAGTCGCTACAGGCCTATATCCCAGCGCGCATCACATCGTGTGCGACCCTCATTTCATCCCCCAACCAGCAACCGCTC
GCGTTCGTCAACCTTGCCTTCTCGAGTGCAGGGCTCACTGCGCTTGGGATCAAGGACGACCTCTACGACGCGCGATTCACCTCTGGCATGTTTGCGGACGCGCAAAACCTTGGGGACGAT
CTCAGCCAATGGGCGGCACCTTTTACTGGGACCACTATCCATGGGGTGTTTGTCATAGGGAGCGACCAG
AATGCGTTTTTGGACCAATACACGAGCGACATTACCTCATTCTTTGGAACC
TCCCTCACGCAAGTCAAGGTAATGAGCGGGTCCTCCCGTCCTGGAACCAATTCTGGACACGAGC
ACTTTGGCTACCTCGACGGCATCTCCCAGCCAGCCATCACAGGCTGGGCAATCGAC
GTCCTCCCAGGTCAAGCCGTCGTGCCCACGGGGGTCATCCTCACGGGACGTTTGGGCGACCCAATGCCCCGCCCAGTATGGGCCATCGACGGGACCTTCATGGCGTTCCGGCACCTGCAA
CAGAAAGTGCCCGAGTTTCACGCCTACACGGTCGCCAACGCCATACGCGCGAGCCCTGCAGGGTTCCTCACACCTCAGCAGGGCGCAGAGCTCCTGGGCGCGCGCATGTTTGGACGTTGG
AAGAGCGGTGCACCATTGGAC
Retrieve as FASTA  
 

<< Back