The peroxidase database
Entry information :
Entry ID 10810
Creation 2012-04-10 (Christophe Dunand)
Last sequence changes 2012-04-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information
Name AbHalPrx05_bisporus
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus External Link
Organism Agaricus bisporus    [TaxId: 5341]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbHalPrx05_bisporus
start..stop
S start..stop
AbHalPrx03_bisporus 478 5e-170 1..370 1..371
AbHalPrx04_bisporus 467 9e-166 1..371 1..373
LbiHalPrx05 428 2e-150 20..371 30..386
AdelHalPrx01 358 4e-123 5..354 1..364
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 615952..616224 273 N° 2 615842..615899 58 N° 3 615622..615792 171 N° 4 615495..615568 74
N° 5 614895..615434 540  
complement(join(614895..615434,615495..615568,615622..615792,615842..615899,6159 52..616224))


exon

Literature and cross-references
Literature
DNA ref. JGI genome: scaffold_3 (616224..614895)
Cluster/Prediction ref. GenPept: 183842
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid 372 (351)
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
40195.76 (38048.5)
PI (pH) %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
4.67 (4.59) Peptide Signal %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 21 range:21-371
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNPFLKLAVLALVTAPLAGAFPSHRSLGGLSSEQLDRIFPTLKVAPPEGPPPPQDDTSTRLVDDADHPFMPAGPNDMRGPCPGLNTLASHGYLPRNGIATPAQVINATMQGFNMEFSLAKFVTYAAFLVDGNPITNLMSIGGKSDLTGEDPPDPATVGGLNTHAVFEGDASMTRADAFFGDNHSFNQTLWDGFVDFSNRFGAGKYNLTVATELRIQRIQDSIATNPQFSFVSPRFITAYAESTFPINFFIDGRQQDGQLDLDAAISFFRDMRYPSGFFRAPKPMGVEGIETIIAAHPIPAGANNGAVNTYTPDPHSGDFNSFCTVYTNFVNETIRGLYPSPTGILKDSLNRNLDFLHDFVSGCPQIFPWGR


Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATCCCTTTCTCAAACTTGCTGTGCTAGCCTTGGTAACTGCACCATTAGCAGGGGCCTTCCCGTCCCATCGCTCCCTTGGTGGCCTCTCTTCAGAACAATTGGATAGAATTTTTCCA
ACGCTCAAGGTAGCTCCTCCGGAAGGTCCTCCGCCGCCTCAGGACGATACGTCGACCAGATTGGTTGATGACGCTGATCATCCATTTATGCCGGCGGGTCCGAATGACATGCGTGGGCCT
TGCCCTGGACTCAATACCCTTGCATCCCACGGG
GTAATTTATCTCTTCGTCTACTCCCAATGCAAATTCACATCCGTCATGACAGTACCTGCCCCGGAATGGAATTGCAACTCCCGCTCA
AGTCATCAATGCTACAATGCAAG
GCGAGTAATTTACAGTTTTTCCTGGAAATCTGGTACTAAAAATTTGCAGGTTTCAACATGGAGTTCTCCCTTGCAAAGTTTGTCACATACGCCGCAT
TCCTGGTAGATGGCAATCCCATTACCAACTTGATGAGTATCGGAGGAAAAAGCGACCTCACTGGTGAAGACCCTCCCGACCCTGCAACGGTCGGTGGTTTGAACACACACGCTGTATTCG
AAG
GTGCTGTGTCTTTTTGAGGGTCGTGGGTTGTATTTAACGATAGGTTCATATAGGTGATGCCAGCATGACCCGGGCCGATGCGTTCTTTGGGGATAACCACAGCTTTAATCAAACATT
GTGGGATGGG
GTACGTACGGTCGTTCTTTGATATTCTTCAATTACTCATATGTCCACCTTTCTCTTTCAGTTTGTCGACTTCAGTAACCGATTTGGTGCCGGGAAATACAACCTAACGGT
GGCCACTGAACTTCGGATCCAAAGAATCCAGGACTCAATCGCAACAAACCCACAATTCTCATTCGTTTCTCCCCGTTTCATCACAGCCTACGCGGAATCTACCTTTCCTATCAACTTTTT
CATTGACGGTCGTCAGCAGGACGGTCAGCTCGACCTCGATGCTGCTATCAGCTTCTTCCGTGATATGAGGTATCCGTCAGGTTTCTTCAGAGCTCCTAAACCAATGGGCGTCGAGGGTAT
CGAGACTATTATAGCTGCTCATCCCATTCCTGCCGGCGCAAACAACGGCGCTGTCAACACCTATACTCCCGACCCTCACTCTGGGGATTTCAATTCGTTCTGCACGGTATACACCAACTT
CGTCAATGAAACGATTAGAGGTTTATATCCTTCGCCGACGGGTATATTGAAAGACAGCTTGAACCGAAACTTGGATTTCCTTCACGATTTTGTATCAGGTTGCCCACAAATCTTCCCGTG
GGGGAGATAA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATCCCTTTCTCAAACTTGCTGTGCTAGCCTTGGTAACTGCACCATTAGCAGGGGCCTTCCCGTCCCATCGCTCCCTTGGTGGCCTCTCTTCAGAACAATTGGATAGAATTTTTCCA
ACGCTCAAGGTAGCTCCTCCGGAAGGTCCTCCGCCGCCTCAGGACGATACGTCGACCAGATTGGTTGATGACGCTGATCATCCATTTATGCCGGCGGGTCCGAATGACATGCGTGGGCCT
TGCCCTGGACTCAATACCCTTGCATCCCACGGG
TACCTGCCCCGGAATGGAATTGCAACTCCCGCTCAAGTCATCAATGCTACAATGCAAGGTTTCAACATGGAGTTCTCCCTTGCAAAG
TTTGTCACATACGCCGCATTCCTGGTAGATGGCAATCCCATTACCAACTTGATGAGTATCGGAGGAAAAAGCGACCTCACTGGTGAAGACCCTCCCGACCCTGCAACGGTCGGTGGTTTG
AACACACACGCTGTATTCGAAG
GTGATGCCAGCATGACCCGGGCCGATGCGTTCTTTGGGGATAACCACAGCTTTAATCAAACATTGTGGGATGGGTTTGTCGACTTCAGTAACCGATTT
GGTGCCGGGAAATACAACCTAACGGTGGCCACTGAACTTCGGATCCAAAGAATCCAGGACTCAATCGCAACAAACCCACAATTCTCATTCGTTTCTCCCCGTTTCATCACAGCCTACGCG
GAATCTACCTTTCCTATCAACTTTTTCATTGACGGTCGTCAGCAGGACGGTCAGCTCGACCTCGATGCTGCTATCAGCTTCTTCCGTGATATGAGGTATCCGTCAGGTTTCTTCAGAGCT
CCTAAACCAATGGGCGTCGAGGGTATCGAGACTATTATAGCTGCTCATCCCATTCCTGCCGGCGCAAACAACGGCGCTGTCAACACCTATACTCCCGACCCTCACTCTGGGGATTTCAAT
TCGTTCTGCACGGTATACACCAACTTCGTCAATGAAACGATTAGAGGTTTATATCCTTCGCCGACGGGTATATTGAAAGACAGCTTGAACCGAAACTTGGATTTCCTTCACGATTTTGTA
TCAGGTTGCCCACAAATCTTCCCGTGGGGGAGATAA
Retrieve as FASTA  
 

<< Back