The peroxidase database
Entry information :
Entry ID 14593
Creation 2017-11-07 (Christophe Dunand)
Last sequence changes 2017-11-07 (Christophe Dunand)
Sequence status N/D
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information
Name HaSTC18HanXRQChr06g0180361
Class Stellacyanin    [Orthogroup: N/D]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus External Link
Organism Helianthus annuus (Sunflower)    [TaxId: 4232]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaSTC18
start..stop
S start..stop
HaSTC27 114 5e-34 1..122 1..125
HaSTC20 106 3e-31 1..122 1..123
HaSTC26 104 2e-30 1..122 1..123
HaSTC25 102 8e-30 12..127 1..119
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 62322994..62323377 384  
join(62322994..62323377)


exon

Literature and cross-references
Literature
DNA ref. HanXRQ genome: HanXRQChr06 (62322994..62323377)
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid 127 (105)
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
14051.67 (11578.5)
PI (pH) %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
6.13 (6.13) Peptide Signal %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 23 range:23-127
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTPFNFNMLMFMAMLVAPMALATQHVVGDNDGWSNPRYPEFYAEWASLHTFNVGDTLFFNFTKEAHDVAEVPQEAYDQCHTEGAKVIIKSAGAVKLTSCGAHHYISTRKGDCETHQKVALYVQPSSV*


Retrieve as FASTA  
Remarks
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACACCATTCAACTTCAACATGCTTATGTTTATGGCCATGTTGGTTGCACCCATGGCCTTGGCGACCCAGCACGTGGTGGGCGATAACGACGGATGGAGTAATCCGAGGTACCCAGAG
TTCTACGCCGAGTGGGCATCCTTACACACCTTCAACGTCGGAGACACTCTCTTTTTTAACTTTACCAAAGAAGCCCATGATGTCGCGGAAGTTCCTCAAGAAGCGTACGATCAATGTCAT
ACCGAAGGCGCTAAAGTCATCATCAAAAGTGCTGGCGCGGTCAAGTTGACCAGCTGCGGAGCACACCACTACATCTCTACGCGTAAGGGTGATTGCGAGACACATCAGAAGGTAGCCTTA
TATGTCCAACCTTCCTCCGTTTGA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACACCATTCAACTTCAACATGCTTATGTTTATGGCCATGTTGGTTGCACCCATGGCCTTGGCGACCCAGCACGTGGTGGGCGATAACGACGGATGGAGTAATCCGAGGTACCCAGAG
TTCTACGCCGAGTGGGCATCCTTACACACCTTCAACGTCGGAGACACTCTCTTTTTTAACTTTACCAAAGAAGCCCATGATGTCGCGGAAGTTCCTCAAGAAGCGTACGATCAATGTCAT
ACCGAAGGCGCTAAAGTCATCATCAAAAGTGCTGGCGCGGTCAAGTTGACCAGCTGCGGAGCACACCACTACATCTCTACGCGTAAGGGTGATTGCGAGACACATCAGAAGGTAGCCTTA
TATGTCCAACCTTCCTCCGTTTGA
Retrieve as FASTA  
cDNA +
Send to BLAST
ATGACACCAT TCAACTTCAA CATGCTTATG TTTATGGCCA TGTTGGTTGC ACCCATGGCC TTGGCGACCC AGCACGTGGT GGGCGATAAC GACGGATGGA GTAATCCGAG GTACCCAGAG  TTCTACGCCG AGTGGGCATC CTTACACACC TTCAACGTCG GAGACACTCT CTTTTTTAAC TTTACCAAAG AAGCCCATGA TGTCGCGGAA GTTCCTCAAG AAGCGTACGA TCAATGTCAT  ACCGAAGGCG CTAAAGTCAT CATCAAAAGT GCTGGCGCGG TCAAGTTGAC CAGCTGCGGA GCACACCACT ACATCTCTAC GCGTAAGGGT GATTGCGAGA CACATCAGAA GGTAGCCTTA  TATGTCCAAC CTTCCTCCGT TTGA 
Retrieve as FASTA  
 

<< Back