The peroxidase database
Entry information :
Entry ID 14600
Creation 2017-11-07 (Christophe Dunand)
Last sequence changes 2017-11-07 (Christophe Dunand)
Sequence status N/D
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information
Name HaSTC25HanXRQChr13g0415061
Class Stellacyanin    [Orthogroup: N/D]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus External Link
Organism Helianthus annuus (Sunflower)    [TaxId: 4232]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaSTC25
start..stop
S start..stop
HaSTC20 219 6e-76 1..118 12..127
HaSTC27 211 7e-73 1..118 12..129
HaSTC26 211 1e-72 1..118 12..127
HaSTC04 210 2e-72 1..118 12..127
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 155970849..155971211 363  
complement(join(155970849..155971211))


exon

Literature and cross-references
Literature
DNA ref. HanXRQ genome: HanXRQChr13 (155971211..155970849)
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid120
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
13078.2
PI (ph)%sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
6.38
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMVASMAFCSSATQHIVGDASGWVIPNNRNLYADWASQRMFTVGDSLVFDFLTGTHDVTEVSKDDYDHCHVSNPGSIITTSRATINLTSPGVHYYICSLEGHCMFHQKLAINVVMKSLF*


Retrieve as FASTA  
Remarks
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATGGTTGCATCCATGGCATTCTGTAGCTCAGCGACGCAACATATTGTGGGCGACGCCTCTGGCTGGGTTATTCCTAACAACCGCAATCTCTACGCTGATTGGGCATCACAAAGG
ATGTTCACCGTCGGTGACTCTTTAGTCTTTGACTTTCTTACAGGAACACATGATGTAACAGAAGTGTCTAAGGATGACTACGATCATTGTCATGTTAGTAACCCAGGATCCATCATAACA
ACCAGCCGTGCAACCATCAACTTGACAAGCCCCGGAGTCCACTATTACATTTGTTCATTGGAGGGACATTGCATGTTTCATCAGAAATTAGCAATTAATGTTGTAATGAAATCTTTATTT
TAA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATGGTTGCATCCATGGCATTCTGTAGCTCAGCGACGCAACATATTGTGGGCGACGCCTCTGGCTGGGTTATTCCTAACAACCGCAATCTCTACGCTGATTGGGCATCACAAAGG
ATGTTCACCGTCGGTGACTCTTTAGTCTTTGACTTTCTTACAGGAACACATGATGTAACAGAAGTGTCTAAGGATGACTACGATCATTGTCATGTTAGTAACCCAGGATCCATCATAACA
ACCAGCCGTGCAACCATCAACTTGACAAGCCCCGGAGTCCACTATTACATTTGTTCATTGGAGGGACATTGCATGTTTCATCAGAAATTAGCAATTAATGTTGTAATGAAATCTTTATTT
TAA
Retrieve as FASTA  
cDNA +
Send to BLAST
ATGGCCATGG TTGCATCCAT GGCATTCTGT AGCTCAGCGA CGCAACATAT TGTGGGCGAC GCCTCTGGCT GGGTTATTCC TAACAACCGC AATCTCTACG CTGATTGGGC ATCACAAAGG  ATGTTCACCG TCGGTGACTC TTTAGTCTTT GACTTTCTTA CAGGAACACA TGATGTAACA GAAGTGTCTA AGGATGACTA CGATCATTGT CATGTTAGTA ACCCAGGATC CATCATAACA  ACCAGCCGTG CAACCATCAA CTTGACAAGC CCCGGAGTCC ACTATTACAT TTGTTCATTG GAGGGACATT GCATGTTTCA TCAGAAATTA GCAATTAATG TTGTAATGAA ATCTTTATTT  TAA 
Retrieve as FASTA  
 

<< Back