The peroxidase database
Entry information :
Entry ID 223
Creation 2006-02-10 (Filippo Passardi)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-05 (Achraf Jemmat)
Peroxidase information
Name (synonym) AtPrx57 (At5g17820 / PER57 / AtperoxP57 / PRXR10 / ATP13a / AtP13 / Atprxr10g)
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis External Link
Organism Arabidopsis thaliana    [TaxId: 3702]
Cellular localisation Cell wall
Tissue types Mixed tissues
Radicles
Root tips
Roots
Roots hairs
Whole seedlings
Inducers Cold stress
Hormon treatment
Light growth
Stress treatment
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx57
start..stop
S start..stop
AlyPrx57 606 0 1..313 1..313
CagraPrx04 600 0 6..313 3..310
BrPrx57-1Aa_other 592 0 6..313 3..310
CrubPrx78 586 0 11..313 8..310
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5889895..5890101 207 N° 2 5888908..5889356 449 N° 3 5888195..5888480 286  
complement(join(5888195..5888480,5888908..5889356,5889895..5890101))


exon

Literature and cross-references
Literature REFERENCE 1 Borderies G, Jamet E, Lafitte C, Rossignol M, Jauneau A, Boudart G, Monsarrat B, Esquerré-Tugayé MT, Boudet A, Pont-Lezica R. Proteomics of loosely bound cell wall proteins of Arabidopsis thaliana cell suspension cultures: a critical analysis. Electrophoresis. 2003 Oct;24(19-20):3421-32.
REFERENCE 2 Tsukagoshi H, Busch W, Benfey PN. Transcriptional regulation of ROS controls transition from proliferation to differentiation in the root. Cell. 2010 Nov 12;143(4):606-16.
Protein ref. UniProtKB: Q43729
DNA ref. Phytozome 11: Chr5 (5890101..5888195)
mRNA ref. GenBank: NM_121788
Cluster/Prediction ref. Phytozome Gene 11: 19666464 UniGene: At.25535
Omic ref. AtProteome: At5g17820 ATTED-II: At5g17820 e-FP Browser: At5g17820 Genevestigator: At5g17820 TAIR: At5g17820
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid 313 (291)
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
33962.43 (31503.1) Transmb domain %sTransmembrane domain
Calculation done with TMHMM
The topology is given as the position of the transmembrane helices
separated by i if the loop is on the inside or o if it is on the outside.
For example i7-29o44-66i87-109o means that it starts on the inside,
has a predicted TMH at position 7 to 29, the outside, then a TMH at position 44-66 etc.
i7-29o
PI (pH) %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
10.67 (10.50) Peptide Signal %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 23 range:23-313
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMKGAKFSSLLVLFFIFPIAFAQLRVGFYSQSCPQAETIVRNLVRQRFGVTPTVTAALLRMHFHDCFVKGCDASLLIDSTNSEKTAGPNGSVREFDLIDRIKAQLEAACPSTVSCADIVTLATRDSVALAGGPSYSIPTGRRDGRVSNNLDVTLPGPTISVSGAVSLFTNKGMNTFDAVALLGAHTVGQGNCGLFSDRITSFQGTGRPDPSMDPALVTSLRNTCRNSATAALDQSSPLRFDNQFFKQIRKRRGVLQVDQRLASDPQTRGIVARYANNNAFFKRQFVRAMVKMGAVDVLTGRNGEIRRNCRRFN


Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 3'), 9 cDNA and 23 ESTs. Mainly from roots. Loosely cell wall bound. Protein evidence in roots. Containing IntR (3').
Promoter +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TAAACGGTAC GTGATATTCT AATATAATCA ATGCAAGTAT AATGTAAGGG AAGAAAATGT CACATTATTA CAACTTACAA GCAAATCAAC CAAATCATTA GTGTTGTGCC AGCTTCTTTA  CACAACTCGC CACGAAACCG ACTTAGACGT AATTTTTAAA ATGATATAAT GAAAGCGTCA AAATAATATT CCCAAACCTC ATCCTCGCTT TCCTCAAGTA ACAAACTTTC CTTCGTCCGC  TTTTGATTTT TTGAACTTTT GACTTTTTGG ATATCATTCC CAAATGTTTT TCAAACATCT CTTGTGAACG TTCCAAAAAA ATTGAAAATG ATTTATTAAT TGTAGAGTAC TCATAATAAT  ATATCAAATC ATTTTTCGGG TATTAGTGTT ACATATTCTT TTGGAGTTCA ATTACGATTT TTTTTTTTTT TTTTAATGTT AAGAATTTTT GAACTTCCGT AATAATGATG GTTCAAACAA  ATTTGAAGGT GAGGAAATCA CGTAAATTTC GAAACTTCAA AGTTCGTTTG GGTTCCCGCT TGTATTTTTT ACTGTTTGTG TTAGGTTATA AGTTGATTTT CTTGTTATTT TTAGTCTTTT  TCTCCTATTT ATATCTCTAC GTAAATTTTG TCGAAATTTT GAAAAATGAT AAAGATGATA AAGATATGTA ACATAAAAAA AAAAGTGTTA AGAAATTTGG AATCTAAGTG TAGATAAATT  TCAAGTTTAT ATTTGGAAAA ATAACTGTAC TTGTAAATAT GAGGATTGCA AAATCTGTCT ACTGTTCATG CATGCTTACT TTTTTAATTA ACTGAAAATT ATCGCTACAC ATATCTTGTT  CAAATGTTTT CGCTTTACTT TTACGATGAA CAACACTAAA TTTTATTAAC TGATCTTACA AAACTTCGAT AATAAAAATG TAGTTACGGC GACTAGTCAT CACACAATAA TTTTAGCACT  ACTTTCAATT CATCCAAAAT AAAAATCGTA ACTAAATTGT GTCTTAAAAT TTACGATTAA GAAATCAGGA CCCTAGCTAG AGTCAAGACT ATAGTATATA TGTACCAACT TCTTTTATTT  TTTGTCGATC ATCATTAGGC ATGACGGATT AACAAATTAA ATCAGTAGTT TTAAGTCTTC ACTATTCATG GATAGATAAT TTGACGACTA AAGTAATCAG TTATCGAACC TCTGGAGTCT  GGATAGATGA CTACATAAGG AGTAATGGAG CAATTGTTGC AATGTCCACA TATTGAGGTA TACTTAATTG GTTATTTGTC TTAATGAAAA ACAAATTCAG AATAATAGTT TATACTAGTA  AAATTAAAAT ATTGCCTCAA CTAATAAGTT GTTATGTGCA ATTATATGTG GTTGTTGTAC ATGTGACCTT AACTAATATT AAGTGAAACA TATACATTTA AAGATAACGC CTAAAATTTA  AATCCTTTTT TTTTTCTTAA GTCCTTCAAA ACATTCTCAA TCATATGAAA GTCTTGTCAA TCAATAAAAG TCCAAAATAT ATATTTTAGA CCCAAGTGGT TTTAGAGAAA CCCCGTTTTA  AATCATTACT ATTTCATTAA ATTTACTTTT ACATTTCTTT CAGAATCGAA GTTGCCAAGA ATATGAAATC GAAATAGATT ACGATGAACA TTAATTACAA TTCTACTATT ATCGACTTAG  CTGGATCAAA TTTTCAGCAT ATCATATACA TTGTAATATA AATTATTAAA TTTACAACAT GGCAAGGAAT GTTACAAAGT CGCTCGCACG CCTTTGCAAA CGTTTCTAAG CTTAATTATC  TAAACAAATA ATATAACCTT TGACTTTCGC ATGTATTCGG CATGTATATG AGGTGTATTA ATCTTTTAGG CTCTAAATTA TATTTCGAAG GTTGGCTTTA TATATATATA TATACCTTAT  GGTTGATCTT AAATGACTCA CAACCCTTTC CACAAGAAGT TATAAACCAA TACATAGAAG AAAACTTCCA ACCCCAAAAA 
Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAACTACAG AAGCGTGGAT ATAATATTAC ATTTGATACA ATATATTTCA AATCTTCTTT ATATTTTTAC TAATTCATTT TTGGTTTTGG TTGGGGTTTT CTTGCATAAA TAAGGCTTTT  CTTAAATTGG ATGGTTTCGA TTTTCGAGAA AGATTACTAT ATATTATATT GTTGGTCTGC ATTTGGTGGA TGTATCTTAA GTTTACAAAT AATTTGTGAT ATTGAAATAT TGATATGTAT  CTTTATCATG GTTAATCATA TATATATATA TATGAATATT GTTTTTCATA AAATTGTCAC TCTATAAGCA AAAACGAACT AAGTATAAAT AAATAAATAA AGTAAAATTT AAACAAAAAT  ATGCATATTC TATCCCTAGT TAACTACAAC TCTACTCTTA TAGACTTAGC TGGATTAAAT TTTCAGCATG ACATATAATC TAAGTAATTA GAAAAGAAAT CTATTATCAA AATAAATTAA  AAAGAAAACA TATCCTGCTG TCAAAAAAGA AAAACACAAA CATATTCATG CATTTTTGGT GAGTATAATA ATATGGGCTT TGACGACAAC AAAAAAAAGG ATAATAATAG TAATATGGGC  TTTGAGATGG GCTAAGTTAT AACTAAGTAA AGCATCCCAG CTTTTAATGG GGCCTCTTTA CTGTCCAACA CCTTTTAGTA AGCATTTTTA GCTGAAGACT CGCATACATC TACAAATTTG  TACGTCGCCA AAATTTATTT TCTAGTTATA CATATATTAA ATGTTAGCAC CTATTTTCTT GATGTAATTT CATTCACTTT CACTCTCCGT AGACCGTAGC TATAATCGTT TAGCCTATTC  TCAAGCAAAG GAGTCTTTGA CTTCTCTTGT AATTGGCCTG GCCAAAGTTT AATGTATATA TCACACTTTG CACCCCAAAA AGCACCTATT TTCTTACAAA ATATGATAAA TCATTTTGCA  CACAATATTA TGTTTGTGGA ATACCTGAAA ACCTAAAAAA 
Retrieve as FASTA  
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAAGGGTGCCAAGTTTTCATCTCTTCTTGTGCTTTTCTTTATTTTTCCGATCGCATTTGCTCAACTGAGAGTCGGGTTTTATAGTCAATCATGCCCTCAAGCCGAGACTATCGTA
CGCAATCTGGTGCGCCAACGGTTTGGTGTTACCCCAACCGTTACCGCCGCTTTGCTCCGTATGCATTTCCACGACTGTTTCGTTAAG
GTAAGGATCTAATATATATTGTTCAACTTTTCC
AACAAAGTCATGTTGCTCAAAGCGGCTTAACTATTATAGTTTGTAATTTCAATCAATTTTTTGAATTTTCTTACATACCTTGTATTTAAAAATGATAATAATATATATTATGAATAATAA
GTTTTATAATATTTTCTTATTATCAATCATATATTAAAATTTGACAATACGAGTTTCTTTTCAAGGTGTTCAATATTTAGTTGAATATGTGATATTTTAGATTTATCTGAAAAATGTTTG
TGTGCTAGCTAGACTGGTCCAAAAATAATGGAGGTGCAAAGTGAATTTAAATGTTATTATCCTTCTAAAATTTTCAATTTTCAATTTAAATAGGATATTAATATATTACTATTATTTTTT
ATTTTAAGTAGGATATATTTAATCACAAACTAAACAAAAATTGTAAATATATGAAATGATCTAAAATAGTAATGATTGGTCTTAAGCGAATTTTCATATCATTTTGTCTATATCATCTTA
TTTTAATATTTTTATGTTCGGATAGGGCTGTGACGCTTCTCTCCTCATTGATTCAACCAATTCCGAGAAAACTGCTGGACCAAACGGAAGCGTCAGGGAATTTGACCTGATAGACCGGAT
CAAGGCTCAGCTAGAAGCTGCATGCCCTTCCACAGTCTCATGTGCTGACATCGTCACATTGGCCACACGTGACTCGGTGGCCTTAGCCGGAGGCCCAAGCTACAGCATCCCCACGGGAAG
GCGTGACGGTAGGGTCTCAAACAATCTTGATGTAACCTTACCGGGTCCAACGATCTCCGTCTCTGGAGCCGTGAGTTTATTCACGAACAAAGGGATGAACACGTTCGATGCAGTAGCTCT
TTTGGGTGCACACACTGTTGGTCAAGGAAATTGTGGTCTCTTTAGTGACAGAATCACTAGCTTCCAAGGAACTGGACGACCGGACCCGTCCATGGACCCCGCTTTGGTTACCAG
GTAATT
TTAAACCGGTCATGGTTCAATCATACGCCACCACTAGAGTCAAAAATTAATTTTATCTTTCGATTAGCAATTTTTTTTATAAATTACATTCGGATTTTATAACTTTTTTTGGAATATTTA
GTCATTAACAAAATATATATGTATAGTTTTCTATATTTCAAAAATATTCAACTTTATTTTATTTTTAAAATATTATTCTCCATATTGAACATTATTTACAGGAAAAAAAAAACAGTTTTA
TCATTAATTAATGATAATTTCAAAATGTTAAAAAAAAAAACAAGCTTAAAACCAATTTTTTCTAAAGTTAAACATATTTGATCCGATCCTTAGACCTAAGCGAAATTAGTTCCATGTTCT
TATTTTGTCTCATTAATATATATCCTAAATGTTTTTCTTATTCTGTTGTGAATGTATGTAGCCTAAGGAACACATGCAGAAATAGCGCGACGGCGGCACTAGACCAGTCGAGTCCATTGA
GATTCGACAACCAGTTCTTCAAGCAAATCCGTAAAAGGAGAGGAGTGTTGCAAGTTGACCAACGCCTCGCATCCGACCCACAGACTCGTGGGATTGTGGCTCGGTATGCTAATAACAACG
CCTTCTTCAAGCGTCAGTTCGTTAGAGCAATGGTGAAGATGGGAGCAGTTGATGTGCTTACTGGTCGTAACGGTGAGATCAGAAGGAACTGCAGGAGATTCAACTAA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAAGGGTGCCAAGTTTTCATCTCTTCTTGTGCTTTTCTTTATTTTTCCGATCGCATTTGCTCAACTGAGAGTCGGGTTTTATAGTCAATCATGCCCTCAAGCCGAGACTATCGTA
CGCAATCTGGTGCGCCAACGGTTTGGTGTTACCCCAACCGTTACCGCCGCTTTGCTCCGTATGCATTTCCACGACTGTTTCGTTAAG
GGCTGTGACGCTTCTCTCCTCATTGATTCAACC
AATTCCGAGAAAACTGCTGGACCAAACGGAAGCGTCAGGGAATTTGACCTGATAGACCGGATCAAGGCTCAGCTAGAAGCTGCATGCCCTTCCACAGTCTCATGTGCTGACATCGTCACA
TTGGCCACACGTGACTCGGTGGCCTTAGCCGGAGGCCCAAGCTACAGCATCCCCACGGGAAGGCGTGACGGTAGGGTCTCAAACAATCTTGATGTAACCTTACCGGGTCCAACGATCTCC
GTCTCTGGAGCCGTGAGTTTATTCACGAACAAAGGGATGAACACGTTCGATGCAGTAGCTCTTTTGGGTGCACACACTGTTGGTCAAGGAAATTGTGGTCTCTTTAGTGACAGAATCACT
AGCTTCCAAGGAACTGGACGACCGGACCCGTCCATGGACCCCGCTTTGGTTACCAG
CCTAAGGAACACATGCAGAAATAGCGCGACGGCGGCACTAGACCAGTCGAGTCCATTGAGATTC
GACAACCAGTTCTTCAAGCAAATCCGTAAAAGGAGAGGAGTGTTGCAAGTTGACCAACGCCTCGCATCCGACCCACAGACTCGTGGGATTGTGGCTCGGTATGCTAATAACAACGCCTTC
TTCAAGCGTCAGTTCGTTAGAGCAATGGTGAAGATGGGAGCAGTTGATGTGCTTACTGGTCGTAACGGTGAGATCAGAAGGAACTGCAGGAGATTCAACTAA
Retrieve as FASTA  
cDNA +
Send to BLAST
TATATACCTT ATGGTTGATC TTAAATGACT CACAACCCTT TCCACAAGAA GTTATAAACC AATACATAGA AGAAAACTTC CAACCCCAAA AAATGATGAA GGGTGCCAAG TTTTCATCTC  TTCTTGTGCT TTTCTTTATT TTTCCGATCG CATTTGCTCA ACTGAGAGTC GGGTTTTATA GTCAATCATG CCCTCAAGCC GAGACTATCG TACGCAATCT GGTGCGCCAA CGGTTTGGTG  TTACCCCAAC CGTTACCGCC GCTTTGCTCC GTATGCATTT CCACGACTGT TTCGTTAAGG GCTGTGACGC TTCTCTCCTC ATTGATTCAA CCAATTCCGA GAAAACTGCT GGACCAAACG  GAAGCGTCAG GGAATTTGAC CTGATAGACC GGATCAAGGC TCAGCTAGAA GCTGCATGCC CTTCCACAGT CTCATGTGCT GACATCGTCA CATTGGCCAC ACGTGACTCG GTGGCCTTAG  CCGGAGGCCC AAGCTACAGC ATCCCCACGG GAAGGCGTGA CGGTAGGGTC TCAAACAATC TTGATGTAAC CTTACCGGGT CCAACGATCT CCGTCTCTGG AGCCGTGAGT TTATTCACGA  ACAAAGGGAT GAACACGTTC GATGCAGTAG CTCTTTTGGG TGCACACACT GTTGGTCAAG GAAATTGTGG TCTCTTTAGT GACAGAATCA CTAGCTTCCA AGGAACTGGA CGACCGGACC  CGTCCATGGA CCCCGCTTTG GTTACCAGCC TAAGGAACAC ATGCAGAAAT AGCGCGACGG CGGCACTAGA CCAGTCGAGT CCATTGAGAT TCGACAACCA GTTCTTCAAG CAAATCCGTA  AAAGGAGAGG AGTGTTGCAA GTTGACCAAC GCCTCGCATC CGACCCACAG ACTCGTGGGA TTGTGGCTCG GTATGCTAAT AACAACGCCT TCTTCAAGCG TCAGTTCGTT AGAGCAATGG  TGAAGATGGG AGCAGTTGAT GTGCTTACTG GTCGTAACGG TGAGATCAGA AGGAACTGCA GGAGATTCAA CTAATGAACT ACAGAAGCGT GGATATAATA TTACATTTGA TACAATATAT  TTCAAATCTT CTTTATATTT TTACTAATTC ATTTTTGGTT TTGGTTGGGG TTTTCTTGCA TAAATAAGGC TTTTCTTAAA TTGGATGGTT TCGATTTTCG AGAAAGATTA CTATATATTA  TATTGTTGGT CTGCATTTGG TGGATGTATC TTAAGTTTAC AAATAATTTG TGATATTGAA ATATTGATAT GTATCTTTAT CATGGTTAAT CATATATATA TATATATGAA TATTGTTTTT  CAT 
Retrieve as FASTA  
 

<< Back