The peroxidase database
Entry information :
Entry ID 237
Creation 2006-02-07 (Filippo Passardi)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-04 (Achraf Jemmat)
Peroxidase information
Name (synonym) AtPrx71 (At5g64120 / PER71 / AtperoxP71 / ATP15a / ATPO2 / AtP15)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis External Link
Organism Arabidopsis thaliana    [TaxId: 3702]
Cellular localisation N/D
Tissue types Callus
Cell culture
Flower buds
Flowers
Mixed tissues
Roots
Siliques
Stamen Abscission Zone
Whole seedlings
Inducers Dark growth
Drought
Hormon treatment
Methyl jasmonate treatment
Pathogen interaction
Stress treatment
Wounding
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx71
start..stop
S start..stop
AhalPrx30 654 0 1..328 1..328
AlyPrx71 647 0 1..328 1..328
CrubPrx67 634 0 1..328 1..328
CagraPrx67 634 0 1..328 1..328
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 25660527..25660946 420 N° 2 25660255..25660417 163 N° 3 25659551..25659954 404  
complement(join(25659551..25659954,25660255..25660417,25660527..25660946))


exon

Literature and cross-references
Literature REFERENCE 1 Cai S, Lashbrook CC. Stamen abscission zone transcriptome profiling reveals new candidates for abscission control: enhanced retention of floral organs in transgenic plants overexpressing Arabidopsis ZINC FINGER PROTEIN2. Plant Physiol. 2008 Mar;146(3):1305-21
Protein ref. UniProtKB: Q43387
DNA ref. Phytozome 11: Chr5 (25660946..25659551)
mRNA ref. GenBank: NM_125808
Cluster/Prediction ref. Phytozome Gene 11: 19671858 UniGene: At.24476
Omic ref. AtProteome: At5g64120 ATTED-II: At5g64120 e-FP Browser: At5g64120 Genevestigator: At5g64120 TAIR: At5g64120
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid 328 (305)
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
34753.61 (32257.2)
PI (pH) %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
8.27 (8.21) Peptide Signal %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 24 range:24-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGLVRSLCLLITFLNCLIISVHGQATARPGPVSGTRIGFYLTTCPRAETIVRNAVNAGFSSDPRIAPGILRMHFHDCFVQGCDGSILISGANTERTAGPNLNLQGFEVIDNAKTQLEAACPGVVSCADILALAARDTVILTQGTGWQVPTGRRDGRVSLASNANNLPGPRDSVAVQQQKFSALGLNTRDLVVLVGGHTIGTAGCGVFRNRLFNTTGQTADPTIDPTFLAQLQTQCPQNGDGSVRVDLDTGSGSTWDTSYYNNLSRGRGVLQSDQVLWTDPATRPIVQQLMAPRSTFNVEFARSMVRMSNIGVVTGANGEIRRVCSAVN


Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns), 9 cDNA and 52 ESTs.
Promoter +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TAAACCGGAG ATACTTCCAA AACTATCCCA CTAATTGCCG GATTCCGCAG TCTGTTATCG ACTCTTCTTA TTATGACTTC GCTCAAAGTC AGCTTCCAAA ACATTATCAA TTTCGAATGT  ATTTATTTAT CTCTTAAAAC CACAAGCCCT AAGTCTTTTG TCGAATGTCC ATACATCACG GACGGATGTG AGACGTTTTT TTAACAAACA AAAAAAATAA AAATGTGAGA CGTCTAGTCG  TATATACAAG AAAATTATAC TGTGGATTAC CCTTTTAGAA GAAAAATATG AAAACAATAT TCATTAATAA AGATAATTGT ATAATTAGAA ACAACAATAT GATAGGAATG TGGTACAATT  TCATTTGTAA TACAGTGGTA CATAGGCTGT AAGTACATGT CATACTTTGA AAATAGTTCG TTCTGCATGC ATTCAAAATT TGAATATGAT TACATTATTT TTTTAATACA TGTAAACGCA  AATGCTAAAC AATATCCTTG TTTGACACAG TCACGGTCAT AATCTCAATC TTAGTTCATT GGTTGAAGAA CTAATATAAT AAAAACATAA ATCGAGCTTT TGACAATAAC AAAAAAAAAT  ATTTAGAGAG GCGTAGACAA ATAAAGCTCA TAATATCCTC AAGGAAAGAT GATCGTTTAG ATCTTATCTT ATAAAGTCAG CGGTCACAAT TTGAGGAATA TAACAATGAT ACTATATGAG  ACTGATACAA AAAAAAATAT ATATATATAA TTTTCATCTA TCTCAATTAA GGTTTTTTTT CGTGTAATCT ACATATATTT GAAGTAGTAC TAGTCTTTGG AGATAATGTG TTTTGTCTCC  AAGATAGGTT TCTGAATAGT ACAATTTATC GCTTAGCACA AGTCGTTAGA AGAACAAATA CATCTGTCTC CATATAAGCT AGGGACCTTG GTTTGTAGAA ACTTCTTAAA TGAACTGCCT  CGGCCCTTTC CTTTAACCAT TAATCTTTTA CGTTATTTAT TAGTCTCTCA TTTGATCATT GCACAATAAA TAACACATTG AAAAAATGTG GTCTGGTGAT ATAGCTAATA AGGTTCATGG  CTTTCTATAG TTTCAAATAT ATAAGAACTG TACGTGAATC ACAAGGGAAA AACTTTGAAT TATAATCATT AGCAATAGTT TATTAAGAAG TTTTTTATTA AAAAAAAAGA GTGTATTATC  ATTTTGTAAA TTACAAAACT GTATTCGCCG TGAAAATATA GTAAGAGTTT GGAGAAACAT AATTAACCTG ATCTTCTTCT TTTTTTACAG AAGAATCTTG AACCAAAATT CAGAGTAATT  AATTTCTAAA GTTTGTGGAA GAACCAGATT GCTTCATGAT TCCAATCACA AGTTAATTCA TTTACTACCA GTAGTTTTAT AGTGAGAATT TATAAACCTT TGGATATTTC CATTATTAAA  ATCCACTTGG CAGACTTTTG CACTTTGTAA ATTAAAGAAG AATTTGATGT TCGTTTTAAT CCTCTAATAT TGAGATCTAC CTACCAAAAA ATGGATGTAT ATACAAATTT CCTAATAACA  AAATAGTATA ATCCTCATTT TTAATTATAT ATTTGCTATA CATCAATTAG GCATGAACCT AAATTCAAAA CTCCTATACG TAAACGATAT TTCCATCATT CGTTACATAA TTCAATCAAT  TTCACACCAA GTAACTATCA AAACGAAAAA AAAAAAAAAA AGTATCAAAA CGAACAAATC CAAAAGAAAA TGCTTTTAAA GTCAACCAGT CGACCAGCTC ACAACGCACT GACCAACACC  ACGCGCTTTT GAATCTCCCA CAAACGGTGT CGTTTTTCAT CTATCCCCCA CAAACACCAA AGCCGGTTTT GTTGACTCAC ACGTCATTCT TTGACTAATC AATCTCCTCT ATAAATAGTA  CTCTATAACG AACTAACTCT ACTCACTATA ACTTAAACAC ACACTTCATC TTCTCTAAAA CCCTAAAATT TAAACACAAG 
Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTAACCGATT AGAATCTGTC GTGATAAACT TTCATGACGC AAAGTACTTG TTTCGAGTGT GGTTTTAATC TGAACAATAA ATAAACCAAT AGAAAACGAC ATACAAAGAA AAAACCCAAA  AGTGGGTTGA TGAAAATTGT ATCTATAAGG TGTTGGTATT CGATTTCTTT TGGTTTTAGT TAAAAAAAAC TGTAATGTCT TCACAAAAAT ATTATAATGA GTTTGGTCCT AGTTTGGATT  CTTAAATTTA TAACCTATGT TAACACATTA TTCAATTCCG AAAATCATAT TCATGCACCA TAACTAATTA ACTATTTACA ACGATATCAA ACGCAAAAAA AGATAAAAAA AAAAAAAAAT  AATAATAATA ATAATAATAA TAATAATGAA TTGATCAAAC TGGCGAATCT TTTGAAATTC TCAGAATCTC AAGGATCAAG GACGGCCAAA TAGTCTTGTC TTCAATAATT TGCAAAACAT  GTTAGTCAAC CTGTCCCTAT CTCTCTAACT TTGAAATCCC TGTTATTAGT TGCATGCATT GTGAAAATTC TCTGGTCTAA CTGCCTAAGT ATGCATGTAT CTGTGTATGT ATATTGTTAG  ATATTTTTAC ATATGTTGAA TCTTATGTTA AACCAGGAAA TGTACGTGTG TGAATTATAA TCAGGAAAAC AAATTGCTTT TTTCTGACAA ATATTTAGTT TATGGATTTA TATACTAGCT  AAATAGTAAA TACTAAAATA GAAAAAAGCA CAATACCGAG ATCTTAAATG ATAATTATAT ACTAATCAGG CAAAGTTGAT CTCCATCATC TTGTCACTGT CATTTTTTTC CCATGCAAAT  GCATGAATCA ATAAACTTTG GCAATCCTAT ATAGGCTATT ATAGTTAATA CATGGTGTGT GCGTTACTAA GTTTGATTTT TTCTATATTA AGTGAATGTA TTAGCTGTAT TGATTTAGAC  CAAGAAAAAA ATTCTTTTCA CACCTTTAAA GAACTAGCT 
Retrieve as FASTA  
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTGGTTAGATCATTGTGCTTATTAATAACCTTCCTTAATTGTCTCATCATCTCGGTTCATGGCCAAGCCACCGCAAGGCCTGGTCCTGTTTCCGGCACTAGGATTGGGTTTTAC
TTAACTACGTGTCCTAGAGCTGAGACTATTGTCCGAAACGCCGTGAATGCTGGTTTCAGTTCTGACCCCAGAATCGCACCCGGAATACTGAGAATGCATTTCCACGACTGTTTTGTCCAA
GGTTGTGACGGTTCGATCCTTATATCCGGAGCTAACACCGAGAGAACCGCCGGTCCGAACCTCAATCTCCAAGGATTTGAAGTCATAGACAACGCCAAAACGCAGCTCGAAGCCGCGTGT
CCTGGAGTTGTCTCTTGTGCTGATATTTTAGCATTAGCCGCTCGTGACACAGTCATTCTC
GTAAGCCTTAATTATTTCATAAACGTTATACGTAATTAATGCATTATCATTACTTTTATA
AGTTTACATGTATATAACGTTATACATGCATGGGTTATTGTGCATGCAGACTCAAGGAACAGGCTGGCAAGTACCAACGGGACGTAGAGATGGTAGAGTTTCTTTGGCTTCGAATGCTAA
CAATCTCCCTGGTCCCCGTGACTCCGTTGCCGTTCAACAACAGAAATTCTCCGCCTTGGGACTCAATACTCGTGATCTCGTCGTCCTCGTCG
GTCAGTAGTCTATACTTTACACAATTTA
AGAAGCCATTCAAGAACTATATATAATTAAACCACCATTATTCCAAAACATTAACATTAAAAAACTAATTTTGTTCGTTGGACACTTGATAACGTCTGGCACCTAAACCTCTTAATCGCT
AATTTTTAAATATATATTTTAAATTCGTAACAATTCTCCATTTTTTCCCGCCTAAAATTTCTGTTAAAAATATTAAAATAATTTTATTGTTTTATCAGTTTTCAGTATTTGAATAATAGC
AACATATACTAAATCAATTACAATTTAAACAGGAGGACACACGATCGGAACAGCAGGATGTGGTGTATTCAGGAACAGGCTATTCAATACCACCGGACAAACCGCAGATCCAACCATCGA
CCCAACATTTTTGGCGCAGCTTCAAACACAATGTCCCCAAAACGGCGACGGTTCAGTGCGCGTGGATCTCGACACCGGAAGCGGAAGCACTTGGGACACTTCTTACTACAACAACCTAAG
CCGTGGGCGTGGAGTTCTCCAATCCGATCAAGTCCTTTGGACCGATCCAGCCACTAGACCCATAGTGCAACAATTGATGGCTCCTAGAAGCACCTTCAACGTTGAGTTTGCGAGGTCAAT
GGTCAGAATGAGTAATATCGGTGTGGTTACCGGAGCTAATGGGGAAATCCGTAGGGTTTGCTCTGCGGTTAATTAA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTGGTTAGATCATTGTGCTTATTAATAACCTTCCTTAATTGTCTCATCATCTCGGTTCATGGCCAAGCCACCGCAAGGCCTGGTCCTGTTTCCGGCACTAGGATTGGGTTTTAC
TTAACTACGTGTCCTAGAGCTGAGACTATTGTCCGAAACGCCGTGAATGCTGGTTTCAGTTCTGACCCCAGAATCGCACCCGGAATACTGAGAATGCATTTCCACGACTGTTTTGTCCAA
GGTTGTGACGGTTCGATCCTTATATCCGGAGCTAACACCGAGAGAACCGCCGGTCCGAACCTCAATCTCCAAGGATTTGAAGTCATAGACAACGCCAAAACGCAGCTCGAAGCCGCGTGT
CCTGGAGTTGTCTCTTGTGCTGATATTTTAGCATTAGCCGCTCGTGACACAGTCATTCTC
ACTCAAGGAACAGGCTGGCAAGTACCAACGGGACGTAGAGATGGTAGAGTTTCTTTGGCT
TCGAATGCTAACAATCTCCCTGGTCCCCGTGACTCCGTTGCCGTTCAACAACAGAAATTCTCCGCCTTGGGACTCAATACTCGTGATCTCGTCGTCCTCGTCG
GAGGACACACGATCGGA
ACAGCAGGATGTGGTGTATTCAGGAACAGGCTATTCAATACCACCGGACAAACCGCAGATCCAACCATCGACCCAACATTTTTGGCGCAGCTTCAAACACAATGTCCCCAAAACGGCGAC
GGTTCAGTGCGCGTGGATCTCGACACCGGAAGCGGAAGCACTTGGGACACTTCTTACTACAACAACCTAAGCCGTGGGCGTGGAGTTCTCCAATCCGATCAAGTCCTTTGGACCGATCCA
GCCACTAGACCCATAGTGCAACAATTGATGGCTCCTAGAAGCACCTTCAACGTTGAGTTTGCGAGGTCAATGGTCAGAATGAGTAATATCGGTGTGGTTACCGGAGCTAATGGGGAAATC
CGTAGGGTTTGCTCTGCGGTTAATTAA
Retrieve as FASTA  
cDNA +
Send to BLAST
ACTATAACTT AAACACACAC TTCATCTTCT CTAAAACCCT AAAATTTAAA CACAAGATGG GTTTGGTTAG ATCATTGTGC TTATTAATAA CCTTCCTTAA TTGTCTCATC ATCTCGGTTC  ATGGCCAAGC CACCGCAAGG CCTGGTCCTG TTTCCGGCAC TAGGATTGGG TTTTACTTAA CTACGTGTCC TAGAGCTGAG ACTATTGTCC GAAACGCCGT GAATGCTGGT TTCAGTTCTG  ACCCCAGAAT CGCACCCGGA ATACTGAGAA TGCATTTCCA CGACTGTTTT GTCCAAGGTT GTGACGGTTC GATCCTTATA TCCGGAGCTA ACACCGAGAG AACCGCCGGT CCGAACCTCA  ATCTCCAAGG ATTTGAAGTC ATAGACAACG CCAAAACGCA GCTCGAAGCC GCGTGTCCTG GAGTTGTCTC TTGTGCTGAT ATTTTAGCAT TAGCCGCTCG TGACACAGTC ATTCTCACTC  AAGGAACAGG CTGGCAAGTA CCAACGGGAC GTAGAGATGG TAGAGTTTCT TTGGCTTCGA ATGCTAACAA TCTCCCTGGT CCCCGTGACT CCGTTGCCGT TCAACAACAG AAATTCTCCG  CCTTGGGACT CAATACTCGT GATCTCGTCG TCCTCGTCGG AGGACACACG ATCGGAACAG CAGGATGTGG TGTATTCAGG AACAGGCTAT TCAATACCAC CGGACAAACC GCAGATCCAA  CCATCGACCC AACATTTTTG GCGCAGCTTC AAACACAATG TCCCCAAAAC GGCGACGGTT CAGTGCGCGT GGATCTCGAC ACCGGAAGCG GAAGCACTTG GGACACTTCT TACTACAACA  ACCTAAGCCG TGGGCGTGGA GTTCTCCAAT CCGATCAAGT CCTTTGGACC GATCCAGCCA CTAGACCCAT AGTGCAACAA TTGATGGCTC CTAGAAGCAC CTTCAACGTT GAGTTTGCGA  GGTCAATGGT CAGAATGAGT AATATCGGTG TGGTTACCGG AGCTAATGGG GAAATCCGTA GGGTTTGCTC TGCGGTTAAT TAATTAACCG ATTAGAATCT GTCGTGATAA ACTTTCATGA  CGCAAAGTAC TTGTTTCGAG TGTGGTTTTA ATCTGAACAA TAAATAAACC AATAGAAAAC GACATACAAA GAAAAAACCC AAAAGTGGGT TGATGAAAAT TGTATCTATA AGGTGTTGGT  ATTCGATTTC TTTTGGTTTT AGTTAAAAAA AACTGTAATG TCTTCACAAA AATATTATAA TGAGTTTGGT CCTAGTTTGG ATTCTTAA 
Retrieve as FASTA  
 

<< Back