The peroxidase database
Entry information :
Entry ID 3555
Creation 2006-10-26 (Christophe Dunand)
Last sequence changes 2016-01-15 (Achraf Jemmat)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-15 (Christophe Dunand)
Peroxidase information
Name AaePxt02
Class Invertebrate peroxinectin    [Orthogroup: Pxt001]
Taxonomy Eukaryota Metazoa Arthropoda Insecta Culicidae Aedes External Link
Organism Aedes aegypti (Yellowfever mosquito)    [TaxId: 7159]
Cellular localisation N/D
Tissue type N/D
Inducer Blood sucking
Repressor N/D
Best BLASTp hits
Perox score E-value AaePxt02
start..stop
S start..stop
AaePxt01 879 0 1..787 1..765
AgaPxt03 724 0 64..786 2..716
DmPxt01-B 499 4e-166 198..750 214..769
DmPxt01-A 486 9e-161 198..750 214..791
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 163383..163530 148 N° 2 163604..164240 637 N° 3 164297..165187 891 N° 4 165247..165943 697
join(163383..163530,163604..164240,164297..165187,165247..165943)


exon

Literature and cross-references
Literature Nene,V. et al., "Genome sequence of Aedes aegypti, a major arbovirus vector. Science 316 (5832), 1718-1723 (2007)
Protein ref. GenBank: AAT27427.1 UniProtKB: P82600
DNA ref. GenBank: AAGE02006854.1 (163383..165943)
mRNA ref. GenBank: AY547316.1
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid 790 (774)
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
89400.39 (87683.4) Transmb domain %sTransmembrane domain
Calculation done with TMHMM
The topology is given as the position of the transmembrane helices
separated by i if the loop is on the inside or o if it is on the outside.
For example i7-29o44-66i87-109o means that it starts on the inside,
has a predicted TMH at position 7 to 29, the outside, then a TMH at position 44-66 etc.
i5-24o
PI (pH) %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
6.4 (6.24) Peptide Signal %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 27 range:17-790
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKKVLLLSLYSAVLSTWFGFGYVQCKLPTSRSEIPNFDYTVAQQPDQSDACEQNEVCMVSVECILDAKKKAILKPCSTVPSVDGVCCPSSEYNGTSSRVQQNSEEHAADHLVLQAIHEGRREYDEKLRFEDEHRAVMTAKEKPEAMFHRMFLPGGLKTHGKEVVDAEEQANVYGHVFASRKYAELTNMTLKQRQGDRFARIPRAIRKRCLPPVPCNPHSRYRTIDGSCNNPLPDRTSWGMEGYPFDRVLEPAYEDGVWAPRIHSVTGNLLPSARVISVALFPDEYRPDPRLNILFMQMGQFISHDFTLSRGFTTKHGQAIECCTPNCTAPLFGPHRHFACFPIEVPPNDPFYSRFGVRCLNLVRIRLAQGPECQLGYAKQADLVTHFLDASTVYGSTNDVAAELRAFQQGRLKDSFPNGIELLPFARNRTACVPWARVCYEGGDIRTNQLLGLTMVHTLFMREHNRLAVGLSKINPHWDDERLYQEARRILIAEYQNVVYNEFLPILLGHERVQQLGLADPFDTYTNYYDPNLRPMTLAEVGAAAHRYGHSLVEGFFRFLTRESPPEDVFIKDIFNDPSKTLEPNSFDVMMFSFNQQPMEQMDRFLTYGLTRFLFKERKPFGSDLASLNIQRGRDFAVRPYNDYREWAGLGRITDFNQLGEVGALLAQVYESPDDVDLWPGGVLEPPAEGAVVGSTFVALLSAGYTRYKRADRYYFTNGPEVNPGAFTLQQLGEIRRTTLAGIICANADHKEDFYQAQEALRQSSADNVPVPCTRYDTVNLGLWREEGF


Retrieve as FASTA  
Remarks Complete sequence from genomic, cDNA and 45 ESTs. Same contig than AaePxt01. also called Chorion peroxidase (secreted in the chorion layer of the mature egg). Two TREMBL link P82600 and Q17CY6.
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGAAAGTATTGCTGCTGAGCCTCTACTCGGCGGTGTTGTCTACGTGGTTCGGGTTCGGATATGTGCAGTGTAAACTACCCACTTCAAGGTCTGAAATTCCCAATTTTGATTAT
ACGGTTGCTCAACAGCCAGATCAAAGCG
GTTAGTATTAGTTTAATGTCATTAGATAAATGTCTACAAATTATAATATCACTCTACTCTTCAATGCCCACAGACGCATGCGAACAAAATGA
AGTCTGTATGGTGTCAGTCGAGTGCATTTTGGACGCCAAAAAGAAAGCCATCTTGAAGCCATGTTCAACTGTGCCCAGCGTCGATGGAGTTTGCTGCCCGTCCAGCGAGTATAATGGAAC
TAGTAGCCGTGTTCAGCAAAACTCTGAAGAACATGCCGCTGATCACTTGGTACTGCAAGCTATTCACGAAGGTCGTCGCGAGTACGACGAGAAGCTTCGATTTGAAGATGAACACCGCGC
GGTAATGACTGCCAAGGAGAAACCAGAAGCCATGTTCCACCGTATGTTTCTTCCCGGCGGTTTGAAGACCCATGGTAAGGAAGTTGTCGATGCGGAAGAGCAAGCCAATGTTTACGGGCA
TGTTTTCGCCAGCCGAAAATACGCCGAGTTGACCAATATGACCTTGAAACAGCGGCAAGGTGATAGGTTTGCGAGAATTCCCCGGGCAATTCGGAAACGCTGTTTGCCACCAGTACCTTG
CAACCCACACTCCCGCTACCGGACCATCGATGGTTCATGCAACAACCCGTTGCCGGACCGCACTAGTTGGGGTATGGAGGGTTATCCTTTTGACCGGGTTTTGGAGCCAGCGTATGAAGA
TGGCGTGTGGGCACCAAG
GTAAGAAAATTAGTTTGTCTTTCTGACTATAGTCTAAAAGAGTATTTATGTTGCAGAATCCATTCGGTGACCGGAAACTTGCTGCCCAGTGCCCGAGTAATC
TCCGTAGCTCTTTTCCCAGATGAGTACAGACCGGATCCGCGCTTGAACATCTTGTTCATGCAGATGGGGCAGTTCATATCGCATGACTTCACTCTTAGTCGTGGTTTTACAACGAAGCAC
GGGCAAGCCATCGAATGCTGTACTCCAAATTGTACGGCACCGCTTTTTGGTCCGCATCGGCATTTTGCGTGCTTCCCAATTGAAGTTCCTCCAAATGATCCGTTCTACTCCCGCTTCGGA
GTCCGCTGTTTGAACCTGGTCCGCATTCGGCTAGCGCAAGGCCCTGAATGTCAACTAGGATATGCCAAGCAAGCCGACCTGGTGACCCACTTCCTCGATGCGTCAACTGTTTACGGTTCG
ACTAATGATGTAGCAGCAGAACTTCGAGCATTTCAGCAGGGTAGACTAAAGGACTCGTTTCCGAATGGTATAGAGCTGCTTCCATTCGCGAGAAATCGTACAGCTTGTGTTCCTTGGGCA
CGGGTATGCTACGAAGGTGGCGACATCCGGACGAACCAGTTGCTTGGCTTAACCATGGTGCACACGTTGTTCATGAGGGAACACAACCGACTAGCTGTGGGCTTGAGTAAGATCAACCCT
CACTGGGACGATGAACGGCTATACCAAGAGGCGCGTAGGATTCTTATAGCAGAATACCAGAATGTTGTGTACAATGAGTTCTTGCCGATCTTGCTTGGTCATGAGAGGGTACAGCAATTA
GGATTAGCCGATCCATTTGATACGTACACAAATTACTATGATCCAAATCTTCGTCCGATGACGCTTGCTGAGGTTGGGGCTGCTGCCCATAGATACGGACATTCTCTGGTGGAAGGTTTC
TTCAG
GTTAGTGAGAGCTTTGGAAGGTGTTGGTTGTCCATTTATTAATTCTGATTTTCACTCAGGTTCCTTACCCGGGAATCCCCACCGGAGGACGTATTCATCAAGGATATCTTCAACG
ATCCCTCCAAAACCCTCGAGCCGAACAGCTTCGACGTCATGATGTTCTCGTTCAATCAGCAGCCGATGGAACAAATGGATCGTTTCCTCACTTACGGTCTAACACGGTTCCTCTTCAAGG
AGCGTAAACCATTCGGATCGGATCTGGCATCTCTCAACATTCAACGAGGTCGGGACTTTGCCGTTCGACCATACAACGACTACCGCGAATGGGCCGGATTAGGTCGAATTACCGACTTTA
ACCAGTTAGGTGAAGTGGGTGCACTCTTGGCACAGGTTTATGAGTCTCCTGACGATGTGGATCTGTGGCCCGGAGGTGTGCTGGAACCTCCAGCGGAAGGTGCCGTAGTGGGTTCAACAT
TTGTTGCTCTGTTGTCCGCTGGCTACACTCGTTACAAGCGTGCCGATCGATACTATTTCACCAACGGTCCTGAGGTAAATCCGGGGGCCTTCACTTTGCAACAACTCGGCGAGATAAGAC
GTACAACGCTGGCCGGCATAATCTGCGCCAATGCGGATCATAAGGAAGATTTCTACCAGGCCCAGGAAGCTTTAAGGCAGTCCAGCGCAGATAATGTTCCCGTTCCTTGCACCCGCTATG
ACACCGTGAACTTAGGTCTGTGGCGAGAGGAAGGTTTTTAA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGAAAGTATTGCTGCTGAGCCTCTACTCGGCGGTGTTGTCTACGTGGTTCGGGTTCGGATATGTGCAGTGTAAACTACCCACTTCAAGGTCTGAAATTCCCAATTTTGATTAT
ACGGTTGCTCAACAGCCAGATCAAAGCG
ACGCATGCGAACAAAATGAAGTCTGTATGGTGTCAGTCGAGTGCATTTTGGACGCCAAAAAGAAAGCCATCTTGAAGCCATGTTCAACTGTG
CCCAGCGTCGATGGAGTTTGCTGCCCGTCCAGCGAGTATAATGGAACTAGTAGCCGTGTTCAGCAAAACTCTGAAGAACATGCCGCTGATCACTTGGTACTGCAAGCTATTCACGAAGGT
CGTCGCGAGTACGACGAGAAGCTTCGATTTGAAGATGAACACCGCGCGGTAATGACTGCCAAGGAGAAACCAGAAGCCATGTTCCACCGTATGTTTCTTCCCGGCGGTTTGAAGACCCAT
GGTAAGGAAGTTGTCGATGCGGAAGAGCAAGCCAATGTTTACGGGCATGTTTTCGCCAGCCGAAAATACGCCGAGTTGACCAATATGACCTTGAAACAGCGGCAAGGTGATAGGTTTGCG
AGAATTCCCCGGGCAATTCGGAAACGCTGTTTGCCACCAGTACCTTGCAACCCACACTCCCGCTACCGGACCATCGATGGTTCATGCAACAACCCGTTGCCGGACCGCACTAGTTGGGGT
ATGGAGGGTTATCCTTTTGACCGGGTTTTGGAGCCAGCGTATGAAGATGGCGTGTGGGCACCAAG
AATCCATTCGGTGACCGGAAACTTGCTGCCCAGTGCCCGAGTAATCTCCGTAGCT
CTTTTCCCAGATGAGTACAGACCGGATCCGCGCTTGAACATCTTGTTCATGCAGATGGGGCAGTTCATATCGCATGACTTCACTCTTAGTCGTGGTTTTACAACGAAGCACGGGCAAGCC
ATCGAATGCTGTACTCCAAATTGTACGGCACCGCTTTTTGGTCCGCATCGGCATTTTGCGTGCTTCCCAATTGAAGTTCCTCCAAATGATCCGTTCTACTCCCGCTTCGGAGTCCGCTGT
TTGAACCTGGTCCGCATTCGGCTAGCGCAAGGCCCTGAATGTCAACTAGGATATGCCAAGCAAGCCGACCTGGTGACCCACTTCCTCGATGCGTCAACTGTTTACGGTTCGACTAATGAT
GTAGCAGCAGAACTTCGAGCATTTCAGCAGGGTAGACTAAAGGACTCGTTTCCGAATGGTATAGAGCTGCTTCCATTCGCGAGAAATCGTACAGCTTGTGTTCCTTGGGCACGGGTATGC
TACGAAGGTGGCGACATCCGGACGAACCAGTTGCTTGGCTTAACCATGGTGCACACGTTGTTCATGAGGGAACACAACCGACTAGCTGTGGGCTTGAGTAAGATCAACCCTCACTGGGAC
GATGAACGGCTATACCAAGAGGCGCGTAGGATTCTTATAGCAGAATACCAGAATGTTGTGTACAATGAGTTCTTGCCGATCTTGCTTGGTCATGAGAGGGTACAGCAATTAGGATTAGCC
GATCCATTTGATACGTACACAAATTACTATGATCCAAATCTTCGTCCGATGACGCTTGCTGAGGTTGGGGCTGCTGCCCATAGATACGGACATTCTCTGGTGGAAGGTTTCTTCAG
GTTC
CTTACCCGGGAATCCCCACCGGAGGACGTATTCATCAAGGATATCTTCAACGATCCCTCCAAAACCCTCGAGCCGAACAGCTTCGACGTCATGATGTTCTCGTTCAATCAGCAGCCGATG
GAACAAATGGATCGTTTCCTCACTTACGGTCTAACACGGTTCCTCTTCAAGGAGCGTAAACCATTCGGATCGGATCTGGCATCTCTCAACATTCAACGAGGTCGGGACTTTGCCGTTCGA
CCATACAACGACTACCGCGAATGGGCCGGATTAGGTCGAATTACCGACTTTAACCAGTTAGGTGAAGTGGGTGCACTCTTGGCACAGGTTTATGAGTCTCCTGACGATGTGGATCTGTGG
CCCGGAGGTGTGCTGGAACCTCCAGCGGAAGGTGCCGTAGTGGGTTCAACATTTGTTGCTCTGTTGTCCGCTGGCTACACTCGTTACAAGCGTGCCGATCGATACTATTTCACCAACGGT
CCTGAGGTAAATCCGGGGGCCTTCACTTTGCAACAACTCGGCGAGATAAGACGTACAACGCTGGCCGGCATAATCTGCGCCAATGCGGATCATAAGGAAGATTTCTACCAGGCCCAGGAA
GCTTTAAGGCAGTCCAGCGCAGATAATGTTCCCGTTCCTTGCACCCGCTATGACACCGTGAACTTAGGTCTGTGGCGAGAGGAAGGTTTTTAA
Retrieve as FASTA  
 

<< Back