The peroxidase database
Entry information :
Entry ID 385
Creation 2008-12-07 (Christophe Dunand)
Last sequence changes 2008-12-07 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-20 (Catherine Mathe)
Peroxidase information
Name (synonym) MtPrx60 (Medtr2g099175.1[4.0])
Class Class III peroxidase    [Orthogroup: Prx032]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago External Link
Organism Medicago truncatula (barrel medic)    [TaxId: 3880]
Cellular localisation N/D
Tissue types Root tips
Roots
Inducers Fungus infection
Glomus versiforme infection
Nitrogen starvation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx60
start..stop
S start..stop
LjPrx22 541 0 5..336 5..334
GmPrx254 522 0 1..336 1..334
GmPrx28 512 0 1..336 1..334
PpePrx77 492 8e-177 4..336 9..342
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 42538930..42539172 243 N° 2 42539572..42539754 183 N° 3 42539877..42540036 160 N° 4 42540116..42540540 425
join(42538930..42539172,42539572..42539754,42539877..42540036,42540116..42540540 )


exon

Literature and cross-references
Literature Journet,E.P. et al., unpublished
DNA ref. Phytozome 11: chr2 (42538930..42540540)
EST ref. GenBank: BG586244 [5' end] GE351515 [3' end]
Cluster/Prediction ref. Phytozome Gene 11: 31067891 TGI: TC91653 [5' end] TC131454 [3' end] UniGene: Mtr.2062 [3' end]
Omic ref. Gene atlas: Mtr.7245.1.S1_at Mtr.9899.1.S1_at Legoo: Mtr.7245.1.S1_at Mtr.9899.1.S1_at
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid 336 (310)
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
37352.83 (34608.4) Transmb domain %sTransmembrane domain
Calculation done with TMHMM
The topology is given as the position of the transmembrane helices
separated by i if the loop is on the inside or o if it is on the outside.
For example i7-29o44-66i87-109o means that it starts on the inside,
has a predicted TMH at position 7 to 29, the outside, then a TMH at position 44-66 etc.
i7-29o
PI (pH) %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
8.6 (8.53) Peptide Signal %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 27 range:27-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGRLMYVAFPLIIAFAVLSLCHGVAAAAATYPKPKLQWHYYHNTCRDAEVYVRHQVKIHWDQDKSITAKLLRLVYSDCFVNGCDASILLDEGPNPEKRAPQNRGLGGFVLIDRIKTVLESRCPGIVSCADILHLAARDAAKMAGAPGYPIFTGRKDGMKSDAASVDLPSPSISWQESLAYFKSKGLNVLDMTTLLGAHTLGQTHCSYIVDRLYNYNGTGNSDPSMDATFRDTLRGLCPPRTKKGQSDPLVYLNPDSGKNYIFRESYYKRILRNEAVLGIDQQLLFGDDTKEITEEFAAGFEDFRRSFAQSMFKMGNIKVLTGNQGEIRRSCRHTNK


Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 3 introns). Cultivar="A17". Containing motif 'YSDC'. 7 ESTs
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAGACTTATGTATGTGGCTTTCCCACTAATAATCGCTTTTGCAGTGTTGAGCTTGTGCCATGGAGTGGCAGCAGCAGCAGCAACTTATCCAAAGCCAAAGTTGCAGTGGCATTAC
TATCACAACACATGCCGCGACGCAGAGGTGTATGTCCGGCACCAAGTGAAGATTCACTGGGATCAAGACAAAAGCATTACTGCCAAGTTACTACGCTTGGTTTACTCCGACTGTTTTGTC
AAT
GTATGTCCCAATTTTATTTTATTTTCTTTTATAATTTAGTACTAGCCAGTCTTTACTTTTCTCCATTTTTCAACTTTTTAAGCTAAGAAAGAGACATCCTGTGAGGTTAATGGCTGA
GAAGGAACTTTTAGGTAATAGGACTAGGAACGACTAAAGGACAGGTTACAAAAACAGCAGACCCTTGCTAAAATATATACAAGTTGCACTAAAAAATATATAGTCTAAACTCAAACACTC
TTGTTGTTCAATCTAAATTCAGCTGTTCCATTTAACTTGGTATTTAGAGTTCATGAGGTTTAAAGCATATGATTCCATTTAAACTTACCATTCTAAACATTATAAATGAACAAGTTTCAT
TTTTCTTTCTCCCGAAACTTAAATCGTTGTTTCGTGGCATAGGGTTGTGATGCATCAATACTGCTTGATGAAGGACCAAATCCAGAAAAAAGAGCACCACAAAACCGGGGGCTTGGAGGA
TTTGTACTAATTGACAGGATCAAAACTGTTCTGGAATCACGATGCCCTGGAATTGTCTCCTGTGCTGATATACTCCATCTCGCAGCTAGGGATGCTGCTAAAATG
GTATTCTTTCAACTA
GTCTACTTACAATTTCCTTCAGTATCCCCTCCGCAGAAAAATCTTCTCTCAAGGTAGGGGTAAAAGTTAAAAAAAACAGTAACCGATTTGAGAATTAATGTCAACAGGCAGGTGCACCGG
GTTATCCAATTTTCACAGGAAGAAAGGATGGCATGAAATCAGATGCTGCATCAGTAGACCTGCCATCACCATCCATTTCATGGCAGGAATCTCTAGCATACTTTAAATCAAAGGGACTGA
ACGTATTAGATATGACAACACTCTTAG
GTAAGGCAAGATTACACAATCAAGTAGAAATTACATGCTAACAATATGTTCTAAATGAGTCTGTTTCATACCAACACAGGAGCGCACACACTC
GGCCAAACACATTGTAGCTACATTGTTGACAGGCTGTATAATTACAATGGTACTGGAAACTCAGACCCAAGCATGGATGCTACTTTTCGAGACACATTGAGGGGACTTTGTCCCCCAAGA
ACAAAGAAAGGACAAAGTGACCCGCTGGTATACCTAAACCCAGACTCTGGAAAAAATTACATCTTCAGAGAATCATACTATAAAAGGATCCTGCGCAATGAAGCTGTCCTGGGAATCGAT
CAACAATTACTATTTGGTGATGACACTAAAGAGATCACCGAAGAATTTGCTGCTGGATTTGAAGATTTTAGGAGATCTTTTGCTCAATCCATGTTCAAAATGGGAAATATCAAAGTTTTA
ACAGGAAATCAAGGAGAGATACGCCGGAGTTGTCGACACACAAATAAGTGA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAGACTTATGTATGTGGCTTTCCCACTAATAATCGCTTTTGCAGTGTTGAGCTTGTGCCATGGAGTGGCAGCAGCAGCAGCAACTTATCCAAAGCCAAAGTTGCAGTGGCATTAC
TATCACAACACATGCCGCGACGCAGAGGTGTATGTCCGGCACCAAGTGAAGATTCACTGGGATCAAGACAAAAGCATTACTGCCAAGTTACTACGCTTGGTTTACTCCGACTGTTTTGTC
AAT
GGTTGTGATGCATCAATACTGCTTGATGAAGGACCAAATCCAGAAAAAAGAGCACCACAAAACCGGGGGCTTGGAGGATTTGTACTAATTGACAGGATCAAAACTGTTCTGGAATCA
CGATGCCCTGGAATTGTCTCCTGTGCTGATATACTCCATCTCGCAGCTAGGGATGCTGCTAAAATG
GCAGGTGCACCGGGTTATCCAATTTTCACAGGAAGAAAGGATGGCATGAAATCA
GATGCTGCATCAGTAGACCTGCCATCACCATCCATTTCATGGCAGGAATCTCTAGCATACTTTAAATCAAAGGGACTGAACGTATTAGATATGACAACACTCTTAG
GAGCGCACACACTC
GGCCAAACACATTGTAGCTACATTGTTGACAGGCTGTATAATTACAATGGTACTGGAAACTCAGACCCAAGCATGGATGCTACTTTTCGAGACACATTGAGGGGACTTTGTCCCCCAAGA
ACAAAGAAAGGACAAAGTGACCCGCTGGTATACCTAAACCCAGACTCTGGAAAAAATTACATCTTCAGAGAATCATACTATAAAAGGATCCTGCGCAATGAAGCTGTCCTGGGAATCGAT
CAACAATTACTATTTGGTGATGACACTAAAGAGATCACCGAAGAATTTGCTGCTGGATTTGAAGATTTTAGGAGATCTTTTGCTCAATCCATGTTCAAAATGGGAAATATCAAAGTTTTA
ACAGGAAATCAAGGAGAGATACGCCGGAGTTGTCGACACACAAATAAGTGA
Retrieve as FASTA  
 

<< Back