The peroxidase database
Entry information :
Entry ID 4202
Creation 2007-01-23 (Filippo Passardi)
Last sequence changes 2012-04-24 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-24 (Christophe Dunand)
Peroxidase information
Name AniHalPrx04
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Emericella External Link
Organism Aspergillus nidulans-Emericella nidulans    [TaxId: 162425]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AniHalPrx04
start..stop
S start..stop
AniHalPrx04_FGSC26 460 2e-165 1..222 1..222
PanHalPrx03 260 5e-87 13..257 6..248
PnoHalPrx04 201 5e-64 17..249 4..238
PnoHalPrx05 172 4e-52 29..250 44..265
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2779294..2780211 918  
join(2779294..2780211)


exon

Literature and cross-references
Literature Galagan JE et al. Sequencing of Aspergillus nidulans and comparative analysis with A. fumigatus and A. oryzae. Nature 438 (7071), 1105-1115 (2005)
Protein ref. GenPept: 40742421 UniProtKB: Q5AV57
DNA ref. JGI genome: ChrIV_A_nidulans_FGSC_A4 (2779294..2780211)
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid305
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
34483.33
PI (ph)%sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
5.05
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLLKSIQNIVCGLVPTFFLFGSAAAELDFEQWHPAGLGDLRCGCPAMNSLANHGFINHNGSNITVNEVIPLMQEVFHLSEELATIVTGLAVLSADDPASGIFNLDMLNRHNIFEHDASLTRKDFYLGGDGHTIDQPTLDEFLSYFDGKEWIDLNDAAAARYARVLDSREKNPSFLYQDQQLITSYGETIKYFRTMVDPRSNKTSAEFVRILFTEERLPVREGWQRPREEISGFSLASDVVQLALRTPEKFIGMPFDQRPFAEQAFDPLPWQRPPIWTPPNYPGFSKRHFSELVGRFAKKALPFRA*


Retrieve as FASTA  
Remarks Complete sequence from Genomic (chromo IV, No intron). Strain="FGSC4".
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGCTCAAGAGCATCCAGAACATTGTCTGTGGCCTCGTGCCAACGTTCTTCCTGTTTGGCTCTGCAGCTGCCGAGCTGGACTTTGAACAGTGGCATCCAGCGGGACTGGGAGACTTG
CGCTGCGGCTGCCCGGCCATGAACAGTCTTGCCAACCACGGGTTCATCAACCATAACGGCAGCAACATCACGGTCAACGAGGTCATCCCGTTGATGCAAGAGGTCTTTCATCTCAGTGAA
GAGCTCGCCACGATTGTCACGGGCCTCGCCGTCCTCTCGGCGGACGACCCTGCCTCGGGTATTTTCAACCTTGATATGCTGAACCGCCACAACATTTTCGAGCACGACGCCTCACTGACC
CGCAAGGATTTCTACCTGGGCGGCGACGGACATACTATTGACCAGCCCACGCTGGACGAGTTCCTCAGCTACTTCGACGGCAAAGAATGGATCGACCTCAACGACGCCGCAGCAGCCCGC
TATGCGCGCGTCCTCGACTCCCGCGAGAAGAACCCGAGCTTCCTCTACCAGGACCAGCAGCTCATTACTTCGTACGGCGAGACGATCAAGTACTTCCGAACCATGGTCGACCCGCGCTCA
AACAAGACATCCGCCGAGTTCGTCAGGATCTTGTTCACCGAGGAGCGGCTGCCCGTCAGGGAAGGGTGGCAGCGCCCGCGAGAAGAGATCAGTGGGTTCTCGCTGGCCAGCGATGTCGTT
CAGCTGGCGCTGCGCACCCCAGAGAAGTTCATTGGCATGCCGTTCGACCAGCGTCCGTTTGCAGAGCAGGCCTTTGACCCGCTGCCATGGCAGCGGCCTCCCATCTGGACTCCCCCGAAC
TACCCGGGTTTCAGTAAGAGGCATTTCTCTGAGCTTGTCGGGAGGTTTGCGAAGAAGGCCCTTCCGTTTCGTGCTTGA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGCTCAAGAGCATCCAGAACATTGTCTGTGGCCTCGTGCCAACGTTCTTCCTGTTTGGCTCTGCAGCTGCCGAGCTGGACTTTGAACAGTGGCATCCAGCGGGACTGGGAGACTTG
CGCTGCGGCTGCCCGGCCATGAACAGTCTTGCCAACCACGGGTTCATCAACCATAACGGCAGCAACATCACGGTCAACGAGGTCATCCCGTTGATGCAAGAGGTCTTTCATCTCAGTGAA
GAGCTCGCCACGATTGTCACGGGCCTCGCCGTCCTCTCGGCGGACGACCCTGCCTCGGGTATTTTCAACCTTGATATGCTGAACCGCCACAACATTTTCGAGCACGACGCCTCACTGACC
CGCAAGGATTTCTACCTGGGCGGCGACGGACATACTATTGACCAGCCCACGCTGGACGAGTTCCTCAGCTACTTCGACGGCAAAGAATGGATCGACCTCAACGACGCCGCAGCAGCCCGC
TATGCGCGCGTCCTCGACTCCCGCGAGAAGAACCCGAGCTTCCTCTACCAGGACCAGCAGCTCATTACTTCGTACGGCGAGACGATCAAGTACTTCCGAACCATGGTCGACCCGCGCTCA
AACAAGACATCCGCCGAGTTCGTCAGGATCTTGTTCACCGAGGAGCGGCTGCCCGTCAGGGAAGGGTGGCAGCGCCCGCGAGAAGAGATCAGTGGGTTCTCGCTGGCCAGCGATGTCGTT
CAGCTGGCGCTGCGCACCCCAGAGAAGTTCATTGGCATGCCGTTCGACCAGCGTCCGTTTGCAGAGCAGGCCTTTGACCCGCTGCCATGGCAGCGGCCTCCCATCTGGACTCCCCCGAAC
TACCCGGGTTTCAGTAAGAGGCATTTCTCTGAGCTTGTCGGGAGGTTTGCGAAGAAGGCCCTTCCGTTTCGTGCTTGA
Retrieve as FASTA  
 

<< Back