The peroxidase database
Entry information :
Entry ID 4224
Creation 2007-01-23 (Filippo Passardi)
Last sequence changes 2010-08-16 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2012-10-25 (Marcel Zamocky)
Peroxidase information
Name (synonym) AbHalPrx01_bisporus (AbHTPx1)
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus External Link
Organism Agaricus bisporus    [TaxId: 5341]
Cellular localisation Cytosolic
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbHalPrx01_bisporus
start..stop
S start..stop
LbiHalPrx01 368 2e-129 1..280 1..282
CcinHalPrx01 365 5e-128 14..282 13..281
CcinHalPrx02 362 3e-127 1..272 1..272
SlutHalPrx05 345 2e-120 8..282 11..282
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 458140..458353 214 N° 2 457867..458073 207 N° 3 457591..457804 214 N° 4 457309..457523 215
N° 5 457249..457253 5  
complement(join(457249..457253,457309..457523,457591..457804,457867..458073,4581 40..458353))


exon

Literature and cross-references
Literature Morales-Almora,P. and Thurston,C.F. Molecular analysis of the cellulolytic genes in Agaricus bisporus. Unpublished
Protein ref. UniProtKB: Q9HGX3
DNA ref. JGI genome: scaffold_10 (458353..457249)
mRNA ref. GenBank: AJ293759
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid284
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
32128.27
PI (ph)%sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
9.07
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFILFKIFHDIAFFSWDLGLTFVNLVLPNRPVGKVTPEGHPGYGGKWPEYIPPKEGDSRCSCPALNAMANHGILPRDGKNIQFKEMGRLIRTTYNFSSSFCYFVPHYAAEKVVKKDYNKDTFNLDELDHHNGIEHDASLCREDSALCPDQSKPHVEYITQLLAHATGKDKDGNPLLTMKDLAKYSSKRRADARSYNKKFTLGFIHRMFGSSNSSTMLTIFGGRVKDLETVLLEERLPENWESRVRGKMGLTFAAFNLTVTPVELMISEKKYLKEKAAKEANKD


Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns) and mRNA. strain="D649".
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCATCCTTTTCAAGATTTTTCACGACATCGCCTTCTTTTCATGGGACCTCGGTCTGACTTTTGTAAACCTCGTCCTTCCGAACAGGCCAGTGGGGAAGGTTACGCCAGAGGGTCAT
CCCGGGTATGGTGGAAAATGGCCTGAATATATTCCTCCAAAGGAGGGTGATAGCAGATGCTCATGTCCGGCATTGAACGCTATGGCGAATCATG
GTGAGATCTCCCTTGTAAAATAAAAA
AAGACTTCATGTGTGATTTTAACACACATTGTTAACCTAGGTATACTCCCTCGTGACGGCAAAAACATCCAGTTCAAAGAGATGGGCAGACTTATCAGGACCACCTACAACTTTTCTTCG
AGTTTCTGCTACTTCGTACCCCACTACGCCGCCGAAAAAGTAGTGAAGAAGGATTATAACAAAGACACGTTTAATCTTGACGAACTTGATCATCACAATGGTATAGAGCATGACGCTTCT
CTCTGTC
GTAAGTTCATCATCTTGTTTAAACAAATTCGGCAGCCAACTAACTCGCCCCTTGTTCACCAGGCGAAGATAGCGCCCTCTGTCCCGATCAAAGCAAGCCTCATGTCGAATACA
TCACGCAACTTCTTGCACACGCCACAGGCAAGGACAAAGATGGCAATCCTCTCCTCACCATGAAGGATCTTGCAAAGTACTCATCCAAACGTCGCGCTGATGCCCGAAGCTATAATAAGA
AATTCACTCTCGGCTTTATTCATCGCATGTTTGGAAGTTCCAA
GTGAGTCATCTGTCGATAATCAGTTTTACTAGGACTGACAAATGATGTGATGTACGTGATATATCAGCTCATCCACT
ATGCTGACCATTTTCGGTGGACGTGTCAAAGATCTTGAAACTGTCTTACTTGAAGAACGACTTCCCGAGAATTGGGAATCGAGGGTTCGGGGAAAGATGGGCTTGACATTCGCGGCATTC
AATCTCACAGTGACACCGGTCGAGCTTATGATCAGTGAAAAGAAATATCTTAAAGAAAAGGCTGCCAAGGAAGCCAACAAAGACG
GTGCTTCTGCTGTCCCGAACCCTGATATACCATGA
AACTGATTTAATGTCATGAGATTAA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCATCCTTTTCAAGATTTTTCACGACATCGCCTTCTTTTCATGGGACCTCGGTCTGACTTTTGTAAACCTCGTCCTTCCGAACAGGCCAGTGGGGAAGGTTACGCCAGAGGGTCAT
CCCGGGTATGGTGGAAAATGGCCTGAATATATTCCTCCAAAGGAGGGTGATAGCAGATGCTCATGTCCGGCATTGAACGCTATGGCGAATCATG
GTATACTCCCTCGTGACGGCAAAAAC
ATCCAGTTCAAAGAGATGGGCAGACTTATCAGGACCACCTACAACTTTTCTTCGAGTTTCTGCTACTTCGTACCCCACTACGCCGCCGAAAAAGTAGTGAAGAAGGATTATAACAAAGAC
ACGTTTAATCTTGACGAACTTGATCATCACAATGGTATAGAGCATGACGCTTCTCTCTGTC
GCGAAGATAGCGCCCTCTGTCCCGATCAAAGCAAGCCTCATGTCGAATACATCACGCAA
CTTCTTGCACACGCCACAGGCAAGGACAAAGATGGCAATCCTCTCCTCACCATGAAGGATCTTGCAAAGTACTCATCCAAACGTCGCGCTGATGCCCGAAGCTATAATAAGAAATTCACT
CTCGGCTTTATTCATCGCATGTTTGGAAGTTCCAA
CTCATCCACTATGCTGACCATTTTCGGTGGACGTGTCAAAGATCTTGAAACTGTCTTACTTGAAGAACGACTTCCCGAGAATTGG
GAATCGAGGGTTCGGGGAAAGATGGGCTTGACATTCGCGGCATTCAATCTCACAGTGACACCGGTCGAGCTTATGATCAGTGAAAAGAAATATCTTAAAGAAAAGGCTGCCAAGGAAGCC
AACAAAGACG
ATTAA
Retrieve as FASTA  
 

<< Back