The peroxidase database
Entry information :
Entry ID 5237
Creation 2007-04-17 (Marcel Zamocky)
Last sequence changes 2012-05-07 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information
Name (synonym) BdeKat01 (BdecatX)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Chytridiomycota Chytridiomycetes Batrachochytrium External Link
Organism Batrachochytrium dendrobatidis    [TaxId: 109871]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdeKat01
start..stop
S start..stop
BhaKat02_C-125 682 0 53..537 20..499
BsKat03_168 665 0 53..546 35..523
PfKat02_Pf5 447 1e-153 47..534 5..473
BsKat01_TE124 445 7e-153 53..536 6..475
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 330799..332439 1641  
join(330799..332439)


exon

Literature and cross-references
Literature Birren,B. et al., The Broad Institute Genome Sequencing Platform. The Genome Sequence of Batrachochytrium dendrobatidis JEL423. Unpublished
DNA ref. JGI genome: scaffold_5 (330799..332439)
mRNA ref. JGI transcript: 10953
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid546
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
60954.96
PI (ph)%sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
6.42
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MICPYAVMACSNPHQGMGTAAPAPAGATTPSSMIKSLDINGKTDDSSMGIIGLTTRQGHAVPDNQNSKSAGSRGPLMLQDYHFQEKMSHFVRERIPERVVHGRGAGAHGYFEAYGSAGNETIGKYTRAKLFDTKGKRTPVFTRFSTVIHGGTSPETLRDPRGFAVKFYTEDGNWDLVGLNLKVFFIRDSIKFPDMVHSLKPDPVTNIQDPNRVFDFMSQTPESTHMLTFLNSPWGIPADYRHMHGSGVNTYKWVNKEGLAHLVKYHWISKQGTKNLKQSEADAVQSNDFNHATDDLYRSIKRGEYPEWELNVQLLTDDEHSELDFDPLDDTKLWPESIAPMLPVGRMVLDRNPVNYYAEVEQAAFGTGVLVDGLDFSDDKMLQGRTFSYGDAQRYRLGVNYLQLPINKPLNKVATNQRDGTMTYFVDGTDAGENPHINYEPSSRNGLVQQPNVYPGPVHEPVLPDGTKIGRAPINRTNPFAQAGETYRSFEDWERDELIMNLGKALAVCNKDIQERMVHNFSQADKDYGARVAKAIEDISSKMMQG*


Retrieve as FASTA  
Remarks Complete sequence from genomic (no intron in ORF predicted). Strain="JEL423".
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATATGTCCCTATGCGGTAATGGCATGTTCGAATCCACACCAGGGTATGGGTACGGCTGCTCCAGCACCTGCTGGAGCTACTACACCATCTTCAATGATTAAATCTCTTGATATAAAC
GGTAAAACGGATGACTCTTCTATGGGCATCATTGGTTTGACTACTCGTCAAGGACATGCAGTTCCAGACAATCAAAACTCGAAATCTGCTGGAAGTCGAGGTCCTCTGATGCTGCAAGAT
TATCATTTTCAGGAGAAAATGTCCCATTTTGTTCGTGAACGTATTCCAGAACGAGTTGTGCATGGACGTGGTGCCGGTGCCCATGGATATTTTGAAGCCTACGGAAGCGCTGGAAACGAG
ACGATTGGCAAGTACACCAGAGCAAAGCTGTTTGACACTAAAGGCAAGCGCACACCTGTGTTTACACGGTTTTCTACTGTTATTCATGGTGGTACTTCACCCGAAACCTTGCGTGATCCC
CGTGGATTCGCAGTCAAGTTCTATACCGAAGACGGTAACTGGGATCTTGTTGGTCTCAATCTCAAGGTGTTTTTTATTCGTGATTCCATCAAGTTTCCCGACATGGTTCACAGTTTGAAA
CCCGATCCAGTCACAAACATTCAAGATCCAAACCGTGTATTCGACTTTATGAGTCAAACTCCCGAGTCAACTCATATGCTGACATTTTTGAATTCGCCATGGGGTATTCCTGCCGACTAT
CGCCACATGCACGGCAGTGGTGTCAACACATACAAGTGGGTCAACAAGGAAGGCTTGGCACACCTTGTCAAATATCACTGGATCTCCAAACAAGGCACCAAAAACCTCAAGCAAAGCGAG
GCTGATGCAGTTCAATCCAACGACTTCAACCATGCTACAGATGATCTGTATCGGTCAATCAAGCGAGGCGAGTATCCAGAATGGGAGTTGAATGTACAACTGTTGACAGATGACGAGCAC
AGTGAATTGGATTTTGATCCTCTTGACGATACCAAACTGTGGCCAGAGTCGATTGCGCCAATGCTTCCAGTTGGACGTATGGTTCTTGATCGTAACCCAGTCAATTACTATGCCGAGGTA
GAGCAGGCGGCATTTGGAACAGGAGTTTTGGTTGACGGATTGGATTTCTCGGACGACAAGATGTTGCAAGGTCGCACGTTCAGTTATGGTGATGCACAACGATATCGTCTTGGTGTCAAT
TATTTACAGTTGCCAATCAACAAACCTTTGAACAAGGTGGCAACCAATCAGCGTGACGGTACAATGACATACTTTGTGGACGGTACAGATGCAGGCGAGAATCCTCATATTAACTACGAG
CCATCCAGTCGCAACGGTCTTGTGCAGCAGCCAAATGTATATCCAGGACCTGTGCATGAGCCTGTTTTACCCGATGGAACCAAGATTGGACGCGCACCTATTAATCGTACGAATCCGTTT
GCTCAAGCTGGCGAGACTTACAGGAGTTTCGAAGATTGGGAACGAGATGAGCTTATTATGAATCTTGGCAAAGCACTTGCAGTATGCAACAAAGACATTCAAGAGCGCATGGTGCATAAC
TTTAGTCAAGCCGATAAAGATTATGGTGCACGAGTTGCCAAAGCGATTGAAGATATTTCTTCAAAGATGATGCAAGGATAA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATATGTCCCTATGCGGTAATGGCATGTTCGAATCCACACCAGGGTATGGGTACGGCTGCTCCAGCACCTGCTGGAGCTACTACACCATCTTCAATGATTAAATCTCTTGATATAAAC
GGTAAAACGGATGACTCTTCTATGGGCATCATTGGTTTGACTACTCGTCAAGGACATGCAGTTCCAGACAATCAAAACTCGAAATCTGCTGGAAGTCGAGGTCCTCTGATGCTGCAAGAT
TATCATTTTCAGGAGAAAATGTCCCATTTTGTTCGTGAACGTATTCCAGAACGAGTTGTGCATGGACGTGGTGCCGGTGCCCATGGATATTTTGAAGCCTACGGAAGCGCTGGAAACGAG
ACGATTGGCAAGTACACCAGAGCAAAGCTGTTTGACACTAAAGGCAAGCGCACACCTGTGTTTACACGGTTTTCTACTGTTATTCATGGTGGTACTTCACCCGAAACCTTGCGTGATCCC
CGTGGATTCGCAGTCAAGTTCTATACCGAAGACGGTAACTGGGATCTTGTTGGTCTCAATCTCAAGGTGTTTTTTATTCGTGATTCCATCAAGTTTCCCGACATGGTTCACAGTTTGAAA
CCCGATCCAGTCACAAACATTCAAGATCCAAACCGTGTATTCGACTTTATGAGTCAAACTCCCGAGTCAACTCATATGCTGACATTTTTGAATTCGCCATGGGGTATTCCTGCCGACTAT
CGCCACATGCACGGCAGTGGTGTCAACACATACAAGTGGGTCAACAAGGAAGGCTTGGCACACCTTGTCAAATATCACTGGATCTCCAAACAAGGCACCAAAAACCTCAAGCAAAGCGAG
GCTGATGCAGTTCAATCCAACGACTTCAACCATGCTACAGATGATCTGTATCGGTCAATCAAGCGAGGCGAGTATCCAGAATGGGAGTTGAATGTACAACTGTTGACAGATGACGAGCAC
AGTGAATTGGATTTTGATCCTCTTGACGATACCAAACTGTGGCCAGAGTCGATTGCGCCAATGCTTCCAGTTGGACGTATGGTTCTTGATCGTAACCCAGTCAATTACTATGCCGAGGTA
GAGCAGGCGGCATTTGGAACAGGAGTTTTGGTTGACGGATTGGATTTCTCGGACGACAAGATGTTGCAAGGTCGCACGTTCAGTTATGGTGATGCACAACGATATCGTCTTGGTGTCAAT
TATTTACAGTTGCCAATCAACAAACCTTTGAACAAGGTGGCAACCAATCAGCGTGACGGTACAATGACATACTTTGTGGACGGTACAGATGCAGGCGAGAATCCTCATATTAACTACGAG
CCATCCAGTCGCAACGGTCTTGTGCAGCAGCCAAATGTATATCCAGGACCTGTGCATGAGCCTGTTTTACCCGATGGAACCAAGATTGGACGCGCACCTATTAATCGTACGAATCCGTTT
GCTCAAGCTGGCGAGACTTACAGGAGTTTCGAAGATTGGGAACGAGATGAGCTTATTATGAATCTTGGCAAAGCACTTGCAGTATGCAACAAAGACATTCAAGAGCGCATGGTGCATAAC
TTTAGTCAAGCCGATAAAGATTATGGTGCACGAGTTGCCAAAGCGATTGAAGATATTTCTTCAAAGATGATGCAAGGATAA
Retrieve as FASTA  
 

<< Back