The peroxidase database
Entry information :
Entry ID 5239
Creation 2007-04-17 (Marcel Zamocky)
Last sequence changes 2007-04-17 (Marcel Zamocky)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information
Name BdeCcP02
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Chytridiomycota Chytridiomycetes Batrachochytrium External Link
Organism Batrachochytrium dendrobatidis    [TaxId: 109871]
Cellular localisation Cytosolic
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdeCcP02
start..stop
S start..stop
SpuCcP02 416 8e-149 5..266 4..265
BemeCcP 407 3e-145 2..268 5..271
CangCcP01 401 5e-143 2..268 6..273
AmaCcP03 397 1e-141 2..268 6..272
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 127434..127654 221 N° 2 127148..127266 119 N° 3 126874..127071 198 N° 4 126535..126806 272
complement(join(126535..126806,126874..127071,127148..127266,127434..127654))


exon

Literature and cross-references
Literature Birren,B. et al., The Broad Institute Genome Sequencing Platform. The Genome Sequence of Batrachochytrium dendrobatidis JEL423. Unpublished
DNA ref. JGI genome: scaffold_10 (127654..126535)
mRNA ref. JGI transcript: 63696
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid269
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
29962.06
PI (ph)%sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
7.22
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTLHDYDAVADDIRSILKNEDWDDGSLGPVLVRLSWHASGTYDHKTKTGGSNGATMRFAPESTDDANAGLEHARRFLEPIKAKHPWITYADLWTLAGVVALHAMNGPKVAWRGRSDKNPKTVTVKDIPPNGRLPDAAQGAHHVRDIFYRMGFNDQEIVALSGAHALGRCHADRSGFSGPWTHTPTRFSNQYFVLLTTVKWTKKVWDGPEQFKDPDDELMMLPTDMALLHDPTFAKYVHLYAKDKEAFSKDFAAAYAKLLELGIPRTKI


Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Strain="JEL423".
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTCTACATGACTACGACGCTGTTGCTGATGATATTCGCAGTATTCTTAAAAACGAGGATTGGGATGACGGTTCTTTAGGTCCTGTACTTGTGCGTCTGTCATGGCATGCTTCTGGT
ACTTATGACCACAAGACAAAAACAGGTGGTTCTAATGGTGCAACCATGCGATTTGCACCCGAGTCCACTGACGATGCTAATGCTGGTCTTGAACATGCTCG
GTATGCATTCACTCATCAT
TGCTGTTTACACTCAATTCATTCGATAGACAAGTATTGATCCATACTGTCGCATTTCCATGTCTGGATGTCTTGTTCATGGTTTTCATTGTTGCGATATCAGATCTGGATGTGTGTATAC
ACTGACGGTCTATCCTTTGTTAAAACAGACGATTCCTTGAACCCATCAAGGCCAAACACCCTTGGATCACCTATGCTGATTTGTGGACCCTTGCTGGAGTGGTTGCTTTGCATGCCATGA
ATGGACCCAAGGTTGCATGGAGACCAG
GTAAACACAATAGTTTGCTCTGTATTCTGAATTCCAAATCTGCATGGATCTATCTATACCAACTCTATTCATCTAGGTCGATCTGACAAGAAT
CCAAAGACGGTTACTGTAAAAGATATTCCTCCAAATGGTCGTCTTCCTGATGCTGCCCAGGGTGCTCATCACGTTCGTGATATCTTTTATCGTATGGGTTTCAACGATCAGGAGATTGTT
GCTCTCAGTGGTGCTCATGCATTGGGTAGATGCCATGCTGACCGTAGTGGTTTTTCTGGAC
GTATGTTGAATTCAAATCTTTAACTTTCCGGTGTTGATGCGTAGTTAACCTGGTATTTA
TACTGTAGCGTGGACTCACACTCCAACCAGGTTTTCCAATCAATATTTTGTTTTATTAACAACTGTGAAATGGACCAAGAAAGTGTGGGATGGGCCAGAGCAATTCAAAGACCCTGATGA
TGAACTCATGATGCTGCCTACTGATATGGCTTTATTACACGATCCGACATTTGCAAAGTATGTCCATCTATATGCCAAAGACAAGGAAGCCTTTTCAAAGGATTTTGCTGCTGCCTATGC
CAAACTTCTTGAATTGGGCATTCCTCGTACCAAGATCTGA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTCTACATGACTACGACGCTGTTGCTGATGATATTCGCAGTATTCTTAAAAACGAGGATTGGGATGACGGTTCTTTAGGTCCTGTACTTGTGCGTCTGTCATGGCATGCTTCTGGT
ACTTATGACCACAAGACAAAAACAGGTGGTTCTAATGGTGCAACCATGCGATTTGCACCCGAGTCCACTGACGATGCTAATGCTGGTCTTGAACATGCTCG
ACGATTCCTTGAACCCATC
AAGGCCAAACACCCTTGGATCACCTATGCTGATTTGTGGACCCTTGCTGGAGTGGTTGCTTTGCATGCCATGAATGGACCCAAGGTTGCATGGAGACCAG
GTCGATCTGACAAGAATCCA
AAGACGGTTACTGTAAAAGATATTCCTCCAAATGGTCGTCTTCCTGATGCTGCCCAGGGTGCTCATCACGTTCGTGATATCTTTTATCGTATGGGTTTCAACGATCAGGAGATTGTTGCT
CTCAGTGGTGCTCATGCATTGGGTAGATGCCATGCTGACCGTAGTGGTTTTTCTGGAC
CGTGGACTCACACTCCAACCAGGTTTTCCAATCAATATTTTGTTTTATTAACAACTGTGAAA
TGGACCAAGAAAGTGTGGGATGGGCCAGAGCAATTCAAAGACCCTGATGATGAACTCATGATGCTGCCTACTGATATGGCTTTATTACACGATCCGACATTTGCAAAGTATGTCCATCTA
TATGCCAAAGACAAGGAAGCCTTTTCAAAGGATTTTGCTGCTGCCTATGCCAAACTTCTTGAATTGGGCATTCCTCGTACCAAGATCTGA
Retrieve as FASTA  
 

<< Back