The peroxidase database
Entry information :
Entry ID 5367
Creation 2007-05-16 (Marcel Zamocky)
Last sequence changes 2014-04-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-04-08 (Christophe Dunand)
Peroxidase information
Name BdeAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Chytridiomycota Chytridiomycetes Batrachochytrium External Link
Organism Batrachochytrium dendrobatidis    [TaxId: 109871]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdeAPx-CcP01
start..stop
S start..stop
NhyAPx03 131 2e-36 44..280 8..243
NhyAPx06 129 1e-35 62..280 27..243
MeAPx08 123 5e-33 63..280 28..241
KflAPx04 123 8e-33 62..280 27..242
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 575525..576126 602 N° 2 575295..575468 174 N° 3 574861..575218 358  
complement(join(574861..575218,575295..575468,575525..576126))


exon

Literature and cross-references
Literature unpublished
DNA ref. JGI genome: scaffold_15 (576126..573146)
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid 377 (357)
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
39874.09 (37632.8) Transmb domain %sTransmembrane domain
Calculation done with TMHMM
The topology is given as the position of the transmembrane helices
separated by i if the loop is on the inside or o if it is on the outside.
For example i7-29o44-66i87-109o means that it starts on the inside,
has a predicted TMH at position 7 to 29, the outside, then a TMH at position 44-66 etc.
o354-376i (o334-356i)
PI (pH) %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
6.41 (6.22) Peptide Signal %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 21 range:21-377
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLIKFFLTTLFLNTITVSAQGIGIAGSPQAAQAGVEQFQFFLQAPGNCLISHTDLPIDAPSKNLAALWIRAVFHDAGTWDPNAVAPALYGGANAGIRSFANVSENAGLFASLAPRFQQNTAVNMSAADTIALAGLTSVTHCGGPHIPYSPGRIDTTTPQTPIGRIPEANERYLTVKPKLQRMGWTNEDIVVLVTGSHTMGGIHAANSPQLTNKSYIPFDTTPGVFDNDVFIRVLAGHCPVPVDCDIANDPELRPIVQRYAADQKAFFDQYAISFAKLSNQVTGVTLNPAMSISIAVHANLLEEGTTDLDGKILSGPNAGMLGNGMSITGSNTTHVNKATPSQQSNSSIMYSSGFILRGFMLCVVWISTCGILSFVN


Retrieve as FASTA  
Remarks Complete from genomic, (6 introns). No EST available. .Strain="JEL423". No prediction from JGI. Very short intergenic region (113 nt) between the heme peroxidase domain and DnaJ domain protein. Possibility of gene fusion but no evidence.
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATTGATAAAGTTCTTTTTAACAACACTGTTTTTAAATACTATAACTGTATCAGCTCAAGGAATTGGTATTGCAGGATCTCCACAAGCAGCTCAAGCAGGTGTAGAACAATTCCAA
TTCTTTCTACAAGCACCAGGAAACTGTCTTATTTCTCATACCGACTTGCCAATAGATGCTCCTTCCAAAAACCTCGCTGCGTTGTGGATTAGAGCTGTATTTCATGATGCAGGAACATGG
GATCCCAATGCTGTTGCTCCAGCACTTTATGGCGGAGCCAATGCAGGAATTAGGTCGTTTGCTAATGTGAGCGAGAATGCAGGACTGTTTGCATCGCTTGCTCCAAGGTTTCAGCAGAAT
ACTGCTGTCAATATGTCGGCTGCTGACACAATTGCTCTTGCTGGATTGACATCAGTAACTCATTGTGGTGGTCCACATATTCCTTACTCCCCTGGAAGAATTGACACCACCACTCCCCAA
ACTCCCATAGGGAGGATCCCTGAAGCAAACGAACGATATCTTACTGTCAAACCCAAACTACAACGCATGGGATGGACAAACGAAGACATTGTTGTCTTGGTAACTGGAAGTCATACTATG
GG
GTAAGTCAAGTCACGTCTTATAAGAAAGCTTAACTGAATCTAACTTGATTGAATAGTGGAATTCATGCAGCCAACTCTCCTCAACTTACAAACAAGTCGTATATTCCGTTTGATACAA
CTCCAGGTGTATTTGATAATGATGTGTTTATTCGAGTGTTGGCTGGTCATTGTCCTGTTCCTGTAGATTGTGATATTGCCAATGATCCAGAGTTGCGTCCTATTGTTCAAAG
GTATACTT
GATTCATGATAAAAGTCTTGAATGGTTTAACATACAGTTTAATTAAATATTCGTATACTGTATGATAGATATGCTGCGGATCAAAAGGCTTTCTTTGACCAATATGCCATTTCATTTGCT
AAACTCTCCAATCAAGTTACTGGAGTAACACTCAATCCAGCCATGAGTATATCTATTGCAGTTCATGCTAATCTGTTGGAAGAAGGCACGACTGATTTGGATGGAAAGATTCTTAGTGGA
CCCAATGCAGGCATGTTAGGAAATGGAATGAGTATAACAGGATCGAATACAACACATGTTAACAAAGCGACACCTTCGCAACAATCCAATAGTTCAATCATGTATTCATCCGGATTCATT
CTAAGAGGATTTATGCTGTGTGTGGTTTGGATAAGCACTTGTGGAATTTTATCTTTTGTAAACTGA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATTGATAAAGTTCTTTTTAACAACACTGTTTTTAAATACTATAACTGTATCAGCTCAAGGAATTGGTATTGCAGGATCTCCACAAGCAGCTCAAGCAGGTGTAGAACAATTCCAA
TTCTTTCTACAAGCACCAGGAAACTGTCTTATTTCTCATACCGACTTGCCAATAGATGCTCCTTCCAAAAACCTCGCTGCGTTGTGGATTAGAGCTGTATTTCATGATGCAGGAACATGG
GATCCCAATGCTGTTGCTCCAGCACTTTATGGCGGAGCCAATGCAGGAATTAGGTCGTTTGCTAATGTGAGCGAGAATGCAGGACTGTTTGCATCGCTTGCTCCAAGGTTTCAGCAGAAT
ACTGCTGTCAATATGTCGGCTGCTGACACAATTGCTCTTGCTGGATTGACATCAGTAACTCATTGTGGTGGTCCACATATTCCTTACTCCCCTGGAAGAATTGACACCACCACTCCCCAA
ACTCCCATAGGGAGGATCCCTGAAGCAAACGAACGATATCTTACTGTCAAACCCAAACTACAACGCATGGGATGGACAAACGAAGACATTGTTGTCTTGGTAACTGGAAGTCATACTATG
GG
TGGAATTCATGCAGCCAACTCTCCTCAACTTACAAACAAGTCGTATATTCCGTTTGATACAACTCCAGGTGTATTTGATAATGATGTGTTTATTCGAGTGTTGGCTGGTCATTGTCCT
GTTCCTGTAGATTGTGATATTGCCAATGATCCAGAGTTGCGTCCTATTGTTCAAAG
ATATGCTGCGGATCAAAAGGCTTTCTTTGACCAATATGCCATTTCATTTGCTAAACTCTCCAAT
CAAGTTACTGGAGTAACACTCAATCCAGCCATGAGTATATCTATTGCAGTTCATGCTAATCTGTTGGAAGAAGGCACGACTGATTTGGATGGAAAGATTCTTAGTGGACCCAATGCAGGC
ATGTTAGGAAATGGAATGAGTATAACAGGATCGAATACAACACATGTTAACAAAGCGACACCTTCGCAACAATCCAATAGTTCAATCATGTATTCATCCGGATTCATTCTAAGAGGATTT
ATGCTGTGTGTGGTTTGGATAAGCACTTGTGGAATTTTATCTTTTGTAAACTGA
Retrieve as FASTA  
 

<< Back