The peroxidase database
Entry information :
Entry ID 6437
Creation 2008-12-23 (Cyril Jourda)
Last sequence changes 2008-12-23 (Cyril Jourda)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-07-07 (Christophe Dunand)
Peroxidase information
Name (synonym) ZmKat1 (cat1 / GRMZM2G088212 [6a])
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea External Link
Organism Zea mays    [TaxId: 4577]
Cellular localisation Peroxisomal
Tissue types Embryosac
Endosperm
Epicotyls
Glumes
Kernels
Leaves
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmKat1
start..stop
S start..stop
SbKat03 1012 0 1..492 1..492
OsKat02 991 0 1..492 1..492
VvKat02 914 0 1..492 1..492
ZaKat01 910 0 1..492 1..492
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 63565224..63565238 15 N° 2 63565396..63565492 97 N° 3 63566433..63566710 278 N° 4 63567406..63568182 777
N° 5 63568311..63568400 90 N° 6 63568563..63568630 68 N° 7 63568736..63568829 94 N° 8 63568941..63569000 60
join(63565224..63565238,63565396..63565492,63566433..63566710,63567406..63568182 ,63568311..63568400,63568563..63568630,63568736..63568829,63568941..63569000)


exon

Literature and cross-references
Literature REFERENCE 1 Redinbaugh M.G., Wadsworth G.J., Scandalios J.G.Characterization of catalase transcripts and their differential expression in maize.Biochim. Biophys. Acta 951:104-116(1988)

REFERENCE 2 Guan L., Scandalios J.G. Characterization of the catalase antioxidant defense gene Cat1 of maize, and its developmentally regulated expression in transgenic tobacco. Plant J. 3:527-536(1993)
Protein ref. UniProtKB: P18122
DNA ref. GenBank: X60135
mRNA ref. GenBank: NM_001111945
Cluster/Prediction ref. TGI: TC439433 UniGene: Zm.83587
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid492
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
56589.17
PI (ph)%sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
7.42
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKHRPSSGSNSSFWTTNSGAPVWNNNSALTVGQRGPILLEDYHLIEKLAQFDRERIPERVVHARGASAKGFFEVTHDVSHLTCADFLRAPGVQTPVIVRFSTVVHERGSPETLRDPRGFAVKFYTRGNFDLVGNNMPVFFIRDGMKFPDMVHAFKPNPKTNLQENWRIVDFFSHHPESLHMFTFLFDDVGIPLNYRHMEGFGVNTYTLINRDGKPHLVKFHWKPTCGVKCLLDNEAVTVGGTCHSHATKDLYDSIAAGNYPEWKLYIQTIDLDHEDKFDFDPLDVTKTWPEDIIPLQPVGRMVLNKNVDNFFAENEQIAFCPAIIVPGIHYSDDKLLQTRIFSYADTQRHRLGPNYLMLPVNAPKCAHHNNHHDGFMNFMHRDEEVNYFPSRFDPARHAEKVPIPPRVLTGCREKCIIQKENNFKQAGERYRSFDPARQDRFIQRWVDALTDPRVTHEHRTIWISYWSCDAALGQKLASRLNLKPSM*


Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 6 introns), 4 mRNA and 150 ESTs.
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCATACAAGGTGCTTTTTTTTCGATTTAGAATTCTTTCTTCATCGATTTTGCCCTATGTGCTAGATCCTCAAATCAATTCCGCATCTTGTTTCCGCCCTTGATTGATGCATTCG
CTCGTCTGACTTGATTGATGCGCTCGATCTGGGGGACTCTTCGTTCTTGCAGCACCGCCCGTCTAGTGGGAGCAACTCCAGCTTCTGGACCACCAACTCCGGCGCCCCCGTCTGGAACAA
CAACTCTGCCCTCACCGTCGGACAGCGAG
GTCAGACCACAACCCCTCTCTCTGTTTATCCTGTAGCTGACATGCTGCTGCCTTCATTTGTCTCGTCTCTCCATCCCGGTTTCATTTTCCC
TTGCACGATCCTGTATGTACTCACTATGTATGTAGCATATATGTTCTTGATTTGTGCGAGACCCATCCGAGGCATAAATGATCTGTTCTAGCTTTGCTTTGAGGCCTATTATTGCACCGT
GGAAGCCAGAGGATTTCGCTTCCCATCCATTCAAAGCTTGCATCTTGATGTGCTTTTAATTAATTTCCAGTGACTAATTTTGCCTGCTCTGTACATGCGGGTTGTCGTTGATTCACCTGT
CCGAATATCGTCAATGAATTTGAGACTTGCCCAAAGGACTTATTCCTTGTATCAGCTGTAAGGTGAAGCTTTTGTCCTGATATTTTTGCCAGTCGCTGTCGAACCATTACGTTACTTAAG
GGAAAGAAAGCACATTCCCGGTACGAAATGCCATCATGGAGTCATAGTGATAATCCTAGGTGAGGGACACTTGGAGAGTAGTAAAGTCAGCGGAGGGTAATCACAGTTAATTGTTACTGA
TACAGTGTGTTTACTTTCGATGGTTACCTGGGGTAGGTTAAATCACTGCTGGAAACCTTAATCCTTGGTTCTTCTTTGTTCAGAATGTATGACCGAGCTTTGAAAGTGATTGCAAGCCCT
GTTTGGCTCTTCTGAATGTCATTGTCAATTTGCCACAAAAAGTGTCCATCAATTGCAGGAACAGGATACATACAATATGCCTATCTGAAACCAATATGTTTCTATCAGAGTATATATGTC
AGAAATATGAGAAGCCTTTTGTTTTAGGAGTTTGTTTTATTGTATAGTACCTGCTTCACTTTCTGTTTTGGTGTTATTAGCTAACAATTGCTGATATATTGTTCCACACGATGTGTTTTT
CTTTGACAGGTCCAATCCTCCTTGAGGATTATCATCTAATCGAAAAGCTTGCTCAGTTCGACAGAGAACGTATCCCTGAACGTGTTGTGCATGCACGGGGAGCCAGTGCCAAGGGTTTCT
TTGAGGTCACTCATGATGTCTCTCACCTTACATGTGCTGATTTTCTCCGTGCTCCTGGGGTCCAGACACCTGTTATTGTCCGTTTCTCTACAGTTGTGCATGAGCGTGGAAGCCCTGAGA
CCTTGAGGGATCCACGTGGTTTTGCTGTCAAGTTCTACACCAGAGAG
GTACTGAGGATAAATTTTAACTCGCCTCCTAGGGGAAAGAGATACATGTCTTAACTGTTCTATTTTTTTTTGT
TATGTCTTAAAAAGAAACATTCTTTTTTAGAACCGTTGTGAGTTATATGATACATCTTGGCAAGTACTTTTCTGTCAATGTATGTTGTATGCATTCATGAAAGCATGTAATATCAAACGT
TTAGCTGATTTCAACTATTGCTTAGTGATGTGTACTTTAGCCCTGTAGATGGTCCTTGACATGAGCTGTTATTCAGACGAAATGATGTCTCTAGGTCATTTTTCTCATAGGAATGAACTG
TATCTTTCTTTTTTCTGTAATTGAAACTTAAGTTACCTCCTCCTGTTTAAGTTGACCTTTGACCTTGCCATGATGAACTTCTTTTTATGAAATTAAATTCTGATTACCTATTTGTGACGC
AGATATAAGTGCCTTTTGCTTAAAAGAACAGTACTCTGGGGCACCATAATGTGCGGTTTGTGTCCAGTATCAGTATAATCAAAGATATTTCATAACTGAATCCATCTCTGTCCAGTTTCC
CCTACATATTGTTGCGCTGTTTGTTTACATTCTTTTACAAATTGTTGGATGCCTTCAAGTGACCCAATTTTTAGAACACTTTATTGACCTTTTTATATCCAGAGGGATAGTATCTTATGG
TTTTCTTCATGCGTTTTTTCAGGGTAACTTTGACCTCGTGGGTAACAACATGCCTGTGTTTTTCATACGAGATGGGATGAAATTCCCTGACATGGTCCACGCTTTCAAGCCGAATCCAAA
GACCAATTTGCAGGAGAACTGGAGAATAGTAGATTTCTTCTCTCACCACCCAGAGAGCCTACACATGTTCACCTTCCTCTTTGACGATGTTGGCATCCCACTCAACTACAGGCACATGGA
GGGCTTTGGTGTCAATACCTACACCTTGATCAACAGGGATGGAAAGCCTCACCTTGTGAAATTCCATTGGAAGCCTACTTGTGGTGTGAAATGCTTGCTCGACAATGAAGCTGTGACTGT
TGGAGGCACCTGCCACAGCCATGCGACGAAGGATCTATATGATTCCATCGCAGCTGGGAATTACCCTGAATGGAAGCTCTACATCCAGACTATTGATCTTGACCATGAGGATAAGTTTGA
CTTTGACCCGCTCGATGTCACCAAGACCTGGCCTGAGGATATCATCCCGCTGCAGCCCGTTGGACGGATGGTCCTGAACAAGAACGTCGACAACTTCTTTGCAGAGAATGAACAGATTGC
TTTCTGCCCAGCGATTATTGTTCCTGGAATTCACTATTCTGATGATAAGCTGCTCCAGACGAGAATCTTCTCCTATGCTGATACCCAGAGGCACCGCCTTGGTCCAAACTATCTGATGCT
TCCTGTGAATGCACCAAAATGTGCCCACCACAATAACCACCATGATGGGTTCATGAACTTCATGCACAGGGACGAAGAG
GTACTATGTTCTTTGGAGTTCTTTTCCCCTTTTGCATGCAA
GTGTGGTGTAGGATGCATCTTACCTGTCGTCATAAGTAACATGTGGGAGTTCTCTGGCACTTATACCTATCCTCTCTGTTTCCTTAGGTGAACTACTTCCCTTCGAGGTTTGATCCCGCC
CGTCACGCGGAGAAGGTCCCCATTCCTCCCCGTGTTCTAACAGGCTGTCGTGAGAAG
GTGTGTATTAAGTTCCAACAGCGCCTTCATGTTATAATAATATTGAGTTATGGTGGGCTTGTG
GCTACATCGTTATACTACATAATGTAATGGTGAAGGAAGGTGAATCATCGTTGGAATTTTTCTTCCTTCTAAACCTTGCTTGTACTGTTGAATCTGCAGTGCATCATTCAGAAGGAGAAC
AACTTCAAGCAGGCTGGCGAGAGATATCGTTCCTTCGACCCTGCAAG
GTTTGCCCCCCACACCTCAGGCTGTCTGGTTTACAGGTATAGGACACTAAGCTGCTGCTTGCCTAAATTCAAG
TGTTTTGGTATCTGTCTATCTGATGATGACAGGCAAGACCGGTTCATCCAGCGATGGGTTGACGCACTGACAGACCCTCGCGTGACCCATGAACACCGTACCATTTGGATCTCCTACTGG
TCCCAG
GTATTCATTTTGTTGTTTGTTTGTTCTTGGTAAAAAATGCTCAGTGGACATGGACATTCGAACGCTTTATCCTGGTACTGAAACCATATTAATTGTCTGTGTGCGCTGCAGTGC
GACGCCGCTCTTGGCCAGAAGCTGGCTTCTAGGCTGAACCTGAAGCCGAGCATGTAA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCATACAAGCACCGCCCGTCTAGTGGGAGCAACTCCAGCTTCTGGACCACCAACTCCGGCGCCCCCGTCTGGAACAACAACTCTGCCCTCACCGTCGGACAGCGAGGTCCAATC
CTCCTTGAGGATTATCATCTAATCGAAAAGCTTGCTCAGTTCGACAGAGAACGTATCCCTGAACGTGTTGTGCATGCACGGGGAGCCAGTGCCAAGGGTTTCTTTGAGGTCACTCATGAT
GTCTCTCACCTTACATGTGCTGATTTTCTCCGTGCTCCTGGGGTCCAGACACCTGTTATTGTCCGTTTCTCTACAGTTGTGCATGAGCGTGGAAGCCCTGAGACCTTGAGGGATCCACGT
GGTTTTGCTGTCAAGTTCTACACCAGAGAG
GGTAACTTTGACCTCGTGGGTAACAACATGCCTGTGTTTTTCATACGAGATGGGATGAAATTCCCTGACATGGTCCACGCTTTCAAGCCG
AATCCAAAGACCAATTTGCAGGAGAACTGGAGAATAGTAGATTTCTTCTCTCACCACCCAGAGAGCCTACACATGTTCACCTTCCTCTTTGACGATGTTGGCATCCCACTCAACTACAGG
CACATGGAGGGCTTTGGTGTCAATACCTACACCTTGATCAACAGGGATGGAAAGCCTCACCTTGTGAAATTCCATTGGAAGCCTACTTGTGGTGTGAAATGCTTGCTCGACAATGAAGCT
GTGACTGTTGGAGGCACCTGCCACAGCCATGCGACGAAGGATCTATATGATTCCATCGCAGCTGGGAATTACCCTGAATGGAAGCTCTACATCCAGACTATTGATCTTGACCATGAGGAT
AAGTTTGACTTTGACCCGCTCGATGTCACCAAGACCTGGCCTGAGGATATCATCCCGCTGCAGCCCGTTGGACGGATGGTCCTGAACAAGAACGTCGACAACTTCTTTGCAGAGAATGAA
CAGATTGCTTTCTGCCCAGCGATTATTGTTCCTGGAATTCACTATTCTGATGATAAGCTGCTCCAGACGAGAATCTTCTCCTATGCTGATACCCAGAGGCACCGCCTTGGTCCAAACTAT
CTGATGCTTCCTGTGAATGCACCAAAATGTGCCCACCACAATAACCACCATGATGGGTTCATGAACTTCATGCACAGGGACGAAGAG
GTGAACTACTTCCCTTCGAGGTTTGATCCCGCC
CGTCACGCGGAGAAGGTCCCCATTCCTCCCCGTGTTCTAACAGGCTGTCGTGAGAAG
TGCATCATTCAGAAGGAGAACAACTTCAAGCAGGCTGGCGAGAGATATCGTTCCTTCGACCCT
GCAAG
GCAAGACCGGTTCATCCAGCGATGGGTTGACGCACTGACAGACCCTCGCGTGACCCATGAACACCGTACCATTTGGATCTCCTACTGGTCCCAGTGCGACGCCGCTCTTGGCCAG
AAGCTGGCTTCTAGGCTGAACCTGAAGCCGAGCATGTAA
Retrieve as FASTA  
 

<< Back