The peroxidase database
Entry information :
Entry ID 6518
Creation 2009-01-24 (Christophe Dunand)
Last sequence changes 2009-01-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-08-13 (Christophe Dunand)
Peroxidase information
Name CcinHalPrx01
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis External Link
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinHalPrx01
start..stop
S start..stop
CcinHalPrx02 538 0 1..271 1..272
LbiHalPrx01 388 4e-137 3..281 7..284
AbHalPrx01_bisporus 365 5e-128 13..281 14..282
LbiHalPrx02 340 5e-118 12..270 16..275
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1287627..1287837 211 N° 2 1287362..1287565 204 N° 3 1287071..1287284 214 N° 4 1286727..1287012 286
complement(join(1286727..1287012,1287071..1287284,1287362..1287565,1287627..1287 837))


exon

Literature and cross-references
Literature Tsang,A., Storms,R. and Butler,G. Expressed sequence tags from Coprinus cinereus cDNA library.
DNA ref. JGI genome: Chr_6 (1287837..1286730)
EST ref. GenBank: DY848129.1 [5' end] DY850806.1 [3' end]
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid304
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
32929.51
PI (ph)%sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
5.26
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGVTGKIRSMRAVAWDVGCTVANLVWPNRKPGSVTPAGCPGAGGKWPEFVPPKEGDSRCSCPALNAMANHGLLPHDGKNIKFSELGDKIRETYNFAPSFCLFVPNYAATMLGKDFNKDTFDLQELDLHNGIEHDASLTREDAALVPDQSKPHIPFIRELLDSATGTDAEGRKLLTIEDLSKYSAKRRVDARETNPEYTLSKVHRTFGSANSSTLLTIFGGRVDDLESILIDERIPDGWESRILEEFGLTIITFNLKTVHKVEGGIDEEKYIAERKATAAAQGNAEGESSSVAKSDSANPSPTGS


Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 3 introns) and 5 ESTs.
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGTAACAGGGAAAATCCGGTCAATGCGAGCGGTAGCATGGGATGTTGGCTGTACTGTTGCGAATCTCGTCTGGCCTAATCGAAAACCCGGGAGCGTGACGCCTGCAGGATGTCCC
GGTGCTGGTGGGAAGTGGCCTGAATTCGTACCTCCCAAAGAGGGCGACAGTCGATGTTCGTGTCCTGCCTTAAATGCGATGGCCAATCATG
GTGCGTTCTGCTACTGTATACGCTAGATT
GGTGAATTGGAAGCCATTGCTTGCAATACTAGGTCTCCTGCCACATGACGGCAAGAACATCAAGTTCTCAGAATTGGGCGACAAGATTCGTGAAACCTACAACTTTGCACCCAGTTTCTG
CCTCTTCGTGCCCAATTACGCTGCCACTATGCTGGGGAAGGACTTTAACAAGGACACTTTCGACCTGCAAGAGCTGGATCTACACAATGGAATCGAGCACGACGCCTCACTGACCC
GTGT
GTCCCTTTTCCATTTGTTCTCCTCCGACTGCCACTGACAGGGTCGCTCATTATGTAAATCTTGGCAATGCTAGGCGAGGATGCGGCGCTCGTTCCTGACCAGTCCAAGCCGCATATCCCT
TTTATTCGGGAGCTTCTTGACTCCGCTACGGGGACAGATGCAGAGGGAAGGAAGCTCCTGACCATCGAAGATCTTTCGAAATACTCGGCGAAGCGCCGCGTTGACGCCCGTGAAACCAAC
CCTGAATATACCCTTAGCAAGGTCCACAGGACATTCGGCAGTGCAAA
GTGCGTGGCTTCAACAGATGTGCTCTCGTTGAGCGTTATCTGACCCCCGTTACCCTAGCTCTTCTACTCTGTT
GACCATCTTTGGTGGCCGTGTGGACGACCTCGAGAGTATCTTGATCGACGAGCGAATCCCGGATGGCTGGGAGTCAAGGATCCTTGAGGAGTTTGGCTTGACGATCATTACGTTCAACTT
GAAGACTGTCCATAAGGTGGAGGGCGGTATTGATGAGGAGAAGTATATTGCTGAGAGGAAGGCGACTGCAGCTGCGCAGGGAAATGCGGAGGGTGAATCGAGCAGCGTTGCCAAATCCGA
TTCAGCCAACCCAAGTCCCACTGGTTCGTAG
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGTAACAGGGAAAATCCGGTCAATGCGAGCGGTAGCATGGGATGTTGGCTGTACTGTTGCGAATCTCGTCTGGCCTAATCGAAAACCCGGGAGCGTGACGCCTGCAGGATGTCCC
GGTGCTGGTGGGAAGTGGCCTGAATTCGTACCTCCCAAAGAGGGCGACAGTCGATGTTCGTGTCCTGCCTTAAATGCGATGGCCAATCATG
GTCTCCTGCCACATGACGGCAAGAACATC
AAGTTCTCAGAATTGGGCGACAAGATTCGTGAAACCTACAACTTTGCACCCAGTTTCTGCCTCTTCGTGCCCAATTACGCTGCCACTATGCTGGGGAAGGACTTTAACAAGGACACTTTC
GACCTGCAAGAGCTGGATCTACACAATGGAATCGAGCACGACGCCTCACTGACCC
GCGAGGATGCGGCGCTCGTTCCTGACCAGTCCAAGCCGCATATCCCTTTTATTCGGGAGCTTCTT
GACTCCGCTACGGGGACAGATGCAGAGGGAAGGAAGCTCCTGACCATCGAAGATCTTTCGAAATACTCGGCGAAGCGCCGCGTTGACGCCCGTGAAACCAACCCTGAATATACCCTTAGC
AAGGTCCACAGGACATTCGGCAGTGCAAA
CTCTTCTACTCTGTTGACCATCTTTGGTGGCCGTGTGGACGACCTCGAGAGTATCTTGATCGACGAGCGAATCCCGGATGGCTGGGAGTCA
AGGATCCTTGAGGAGTTTGGCTTGACGATCATTACGTTCAACTTGAAGACTGTCCATAAGGTGGAGGGCGGTATTGATGAGGAGAAGTATATTGCTGAGAGGAAGGCGACTGCAGCTGCG
CAGGGAAATGCGGAGGGTGAATCGAGCAGCGTTGCCAAATCCGATTCAGCCAACCCAAGTCCCACTGGTTCGTAG
Retrieve as FASTA  
 

<< Back