The peroxidase database
Entry information :
Entry ID 6553
Creation 2009-01-30 (Christophe Dunand)
Last sequence changes 2010-08-13 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-08-13 (Christophe Dunand)
Peroxidase information
Name CcinHalPrx02
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis External Link
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinHalPrx02
start..stop
S start..stop
CcinHalPrx01 570 0 1..295 1..292
LbiHalPrx01 386 2e-136 4..280 7..282
AbHalPrx01_bisporus 370 4e-130 1..280 1..280
LbiHalPrx02 339 7e-118 15..271 18..275
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3102430..3102643 214 N° 2 3102764..3102967 204 N° 3 3103041..3103254 214 N° 4 3103356..3103611 256
join(3102430..3102643,3102764..3102967,3103041..3103254,3103356..3103611)


exon

Literature and cross-references
Literature
DNA ref. JGI genome: Chr_4 (3102430..3103611)
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid295
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
32100.1
PI (ph)%sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
5.27
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGVIAGKFRSLRAVTWDAGCTMGNLVWPNRKPGSVTPAGCPGAGGKWPEFVPPKEGDSRCSCPALNAMANHGILPHDGKNIKFSEMGDKIRETYNFAPSFCLFVPNYAATMLGKDFNKDTFDLQELDLHNGIEHDASLTREDAALVPDQSKPHIPFIRELLDSATGTDAEGRKVLTIEDLSKYSAKRRVDARETNPEYTLSKVHRTFGSANSSTLLTIFGGRVDDLESILIEERIPDGWESRILEEFGLTIITFNVKTVNKVERGIDEEKYIAEKKATAAAAAQGNAEGESSGVA


Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 4 introns). No EST.
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGTTATTGCAGGGAAATTCAGATCATTGCGCGCGGTCACATGGGATGCTGGCTGCACCATGGGGAATCTAGTCTGGCCTAACCGAAAACCTGGGAGCGTGACGCCCGCAGGATGT
CCCGGCGCCGGTGGCAAGTGGCCTGAATTCGTACCTCCCAAAGAAGGCGACAGTCGGTGTTCGTGTCCTGCTTTAAACGCGATGGCTAATCATG
GTACGTACATACATATCATACATACG
TCCTGCTCCTGTACTCGTATTCCCTCGATTGGGTGATTGGATTAACAAGTCATTTTTTTCTTTTCTTTTTTGGGGGGCACTATGTACCATGTAGGTATCCTGCCACACGACGGGAAGAAC
ATCAAGTTCTCAGAAATGGGCGACAAGATTCGCGAAACATACAACTTTGCACCGAGCTTCTGCCTCTTCGTGCCCAACTACGCTGCCACCATGCTGGGGAAGGACTTCAACAAGGACACG
TTCGACCTGCAAGAGCTGGATCTACACAATGGGATTGAGCACGACGCCTCGCTGACCC
GTGTGTCCTTTTCCTTTTGTTCCCCCTCGTCTAACAGGATCGTCCATTTAAATCTTGGCAAT
GCTAATGCTAGGCGAGGATGCGGCGCTCGTTCCTGACCAGTCCAAGCCGCATATCCCTTTTATTCGTGAGCTTCTTGACTCCGCTACGGGGACAGATGCAGAAGGAAGGAAGGTCCTGAC
CATTGAAGATCTTTCCAAGTACTCCGCGAAGCGCCGCGTCGACGCCCGCGAAACTAACCCCGAATACACCCTCAGCAAGGTCCACAGGACTTTTGGCAGTGCAAA
GTGCGTACATAGCTT
TCAACACTTCAACAGATACTCTTACGTTGAGTGTAATCTGTAATCTGACTTTCTTTTTTTTTTTTTTTCTTTTTTTGTTACGCCAGCTCTTCTACTCTTTTGACCATTTTTGGCGGCCGG
GTGGACGACCTCGAGAGCATCTTGATCGAGGAACGGATCCCTGATGGTTGGGAGTCGAGGATCCTTGAAGAGTTTGGCTTGACGATTATCACGTTCAACGTGAAGACTGTCAATAAGGTG
GAGCGCGGTATCGATGAGGAGAAGTATATCGCTGAGAAGAAGGCGACGGCTGCTGCAGCTGCTCAGGGAAATGCGGAGGGTGAATCGAGCGGCGTTGCCTAA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGTTATTGCAGGGAAATTCAGATCATTGCGCGCGGTCACATGGGATGCTGGCTGCACCATGGGGAATCTAGTCTGGCCTAACCGAAAACCTGGGAGCGTGACGCCCGCAGGATGT
CCCGGCGCCGGTGGCAAGTGGCCTGAATTCGTACCTCCCAAAGAAGGCGACAGTCGGTGTTCGTGTCCTGCTTTAAACGCGATGGCTAATCATG
GTATCCTGCCACACGACGGGAAGAAC
ATCAAGTTCTCAGAAATGGGCGACAAGATTCGCGAAACATACAACTTTGCACCGAGCTTCTGCCTCTTCGTGCCCAACTACGCTGCCACCATGCTGGGGAAGGACTTCAACAAGGACACG
TTCGACCTGCAAGAGCTGGATCTACACAATGGGATTGAGCACGACGCCTCGCTGACCC
GCGAGGATGCGGCGCTCGTTCCTGACCAGTCCAAGCCGCATATCCCTTTTATTCGTGAGCTT
CTTGACTCCGCTACGGGGACAGATGCAGAAGGAAGGAAGGTCCTGACCATTGAAGATCTTTCCAAGTACTCCGCGAAGCGCCGCGTCGACGCCCGCGAAACTAACCCCGAATACACCCTC
AGCAAGGTCCACAGGACTTTTGGCAGTGCAAA
CTCTTCTACTCTTTTGACCATTTTTGGCGGCCGGGTGGACGACCTCGAGAGCATCTTGATCGAGGAACGGATCCCTGATGGTTGGGAG
TCGAGGATCCTTGAAGAGTTTGGCTTGACGATTATCACGTTCAACGTGAAGACTGTCAATAAGGTGGAGCGCGGTATCGATGAGGAGAAGTATATCGCTGAGAAGAAGGCGACGGCTGCT
GCAGCTGCTCAGGGAAATGCGGAGGGTGAATCGAGCGGCGTTGCCTAA
Retrieve as FASTA  
 

<< Back