The peroxidase database
Entry information :
Entry ID 6767
Creation 2009-05-07 (Christophe Dunand)
Last sequence changes 2009-05-07 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information
Name BdeKat02
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Chytridiomycota Chytridiomycetes Batrachochytrium External Link
Organism Batrachochytrium dendrobatidis    [TaxId: 109871]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdeKat02
start..stop
S start..stop
OiKat 1133 0 1..673 1..673
BalKat01 907 0 9..670 14..681
BsKat02_168 906 0 9..670 14..684
BhaKat01_C-125 855 0 7..674 13..706
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2046..4070 2025  
join(2046..4070)


exon

Literature and cross-references
Literature
DNA ref. JGI genome: scaffold_105 (2046..4070)
mRNA ref. JGI transcript: 15126
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid674
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
76553.45
PI (ph)%sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
6.06
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSKEKYNQKNEQLDQYRVKDEGKALTTNHGLKMAEDEFSLKAGERGPTLLEDFHFREKMTHFDHERIPERVVHARGFAAHGEFEVYESLAPYTKARFLNEPGKKTPVFVRFSTVAGSRGSGDLARDVRGFATKFYTEEGNYDLVGNNMPVFFIQDGIKFPDFIHAVKPEPHNEIPQAQSAHDTFWDFVANNQETAHMVMWHMSDRAIPRSFRMMEGFGVHTYRLVNEKGQAFFVKFHWKPVLGVHSVVWDEAQKISGKDPDFHRRDLYEAIENGDYPVYELGLQIINEEDEFKFDFDILDATKLWPEEDVPVQIVGKMTLNRNVDNYFAETEQVAFHPGHVVPGIDFSNDPLLQTRLFSYTDTQLIRLGGPNFHELPINRPVAQFHNNQRDGFGRQTINTSKVSYYKNSLAQNTPGPVSEEEGGFSHYQEKVEGRKVRARSESFKDHFSQAILFWNSMSNVEKQHIINAFSFELGKCKEVSVREQVLEMFSNVNHELVTKIAENLGLPVPMKKEITYAKSSPALSQENTIKKTNTRKVAVIAADGYPKELSAMIKELKSIGANVEIVSDHQGTIQGSDNTQLPVDHTLMTADSVLFDAVLIANQNGKTPLFGKEAPYFVKEALLHYKPIGAIKEGAVILEDLQISGQDGVVIDDSQQFIEAVRKARFWDREGKN*


Retrieve as FASTA  
Remarks Complete sequence from genomic (no intron). No EST.
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCAAAGAAAAGTATAATCAAAAGAATGAACAGCTCGATCAATATCGGGTGAAGGATGAAGGCAAAGCACTGACAACCAATCATGGACTGAAAATGGCGGAAGATGAGTTTTCATTA
AAAGCTGGTGAGCGCGGTCCTACATTATTAGAGGACTTCCATTTTCGCGAAAAGATGACTCACTTTGATCACGAGCGGATTCCAGAACGTGTTGTTCATGCCAGAGGGTTTGCAGCCCAT
GGTGAATTTGAAGTCTATGAGTCACTCGCTCCCTATACAAAGGCTAGATTTTTAAATGAGCCTGGAAAGAAAACGCCTGTATTTGTCCGTTTTTCTACAGTCGCTGGTTCTCGCGGATCA
GGGGATTTAGCACGTGATGTCCGCGGGTTTGCAACAAAATTCTATACAGAAGAAGGGAATTATGATCTGGTTGGAAATAATATGCCTGTCTTCTTTATTCAGGATGGCATTAAATTCCCC
GACTTTATCCATGCAGTTAAGCCAGAACCGCACAACGAGATTCCTCAGGCACAGTCTGCACACGATACATTCTGGGATTTTGTGGCCAATAATCAGGAAACGGCCCATATGGTCATGTGG
CACATGTCAGACCGTGCTATCCCAAGAAGCTTCCGGATGATGGAAGGGTTTGGAGTACATACATACCGCTTAGTCAATGAAAAAGGACAAGCCTTCTTTGTGAAATTCCACTGGAAACCA
GTGCTTGGTGTGCATTCTGTTGTGTGGGATGAAGCACAAAAGATTAGCGGAAAAGATCCAGACTTCCACCGCCGTGATTTATATGAAGCAATTGAAAATGGCGATTATCCTGTCTATGAG
CTGGGCTTGCAAATTATTAATGAAGAAGATGAATTTAAATTCGATTTTGATATTCTCGACGCAACGAAACTCTGGCCAGAAGAAGATGTCCCAGTACAAATTGTCGGTAAAATGACACTA
AACCGAAATGTGGATAATTACTTTGCTGAAACGGAGCAAGTAGCCTTCCATCCCGGACATGTTGTTCCAGGTATTGACTTTAGTAATGATCCACTCTTACAGACACGTCTATTCTCTTAC
ACGGATACTCAGCTGATTCGTCTGGGTGGACCGAATTTCCATGAACTTCCGATTAATAGACCGGTTGCCCAATTCCACAACAACCAGCGGGATGGCTTTGGACGCCAGACCATTAATACG
AGTAAGGTGAGCTATTATAAGAATTCTCTGGCTCAAAATACACCAGGACCGGTCAGCGAGGAGGAGGGAGGATTCAGCCATTACCAGGAAAAAGTGGAAGGCCGCAAAGTCCGCGCTCGC
AGTGAAAGCTTTAAAGACCACTTCTCCCAAGCCATTCTTTTCTGGAATAGTATGAGCAATGTGGAGAAACAGCATATCATTAATGCATTCAGTTTTGAGCTTGGAAAATGTAAAGAAGTA
TCTGTACGCGAGCAAGTTTTAGAAATGTTCTCGAATGTTAACCATGAGCTGGTAACTAAGATTGCAGAAAATCTCGGTCTGCCTGTTCCTATGAAAAAGGAAATAACTTATGCAAAATCC
TCACCAGCCCTAAGTCAGGAAAACACCATCAAGAAAACTAATACACGCAAGGTAGCTGTCATTGCAGCAGACGGATATCCTAAAGAATTGTCTGCAATGATTAAAGAATTAAAATCTATT
GGCGCAAACGTTGAGATTGTAAGTGATCATCAAGGCACCATTCAAGGTAGTGACAACACGCAACTTCCAGTTGATCACACACTGATGACCGCAGATTCAGTTCTGTTTGATGCCGTTCTG
ATTGCCAACCAAAATGGTAAAACTCCATTATTCGGTAAAGAAGCACCTTATTTTGTCAAGGAGGCGCTCCTGCATTACAAACCAATCGGAGCGATAAAGGAAGGAGCCGTAATTCTAGAG
GACTTGCAAATTTCTGGACAAGATGGTGTAGTCATTGATGACAGCCAGCAATTTATAGAAGCTGTTCGTAAAGCTAGATTCTGGGATCGTGAAGGTAAAAACTAA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCAAAGAAAAGTATAATCAAAAGAATGAACAGCTCGATCAATATCGGGTGAAGGATGAAGGCAAAGCACTGACAACCAATCATGGACTGAAAATGGCGGAAGATGAGTTTTCATTA
AAAGCTGGTGAGCGCGGTCCTACATTATTAGAGGACTTCCATTTTCGCGAAAAGATGACTCACTTTGATCACGAGCGGATTCCAGAACGTGTTGTTCATGCCAGAGGGTTTGCAGCCCAT
GGTGAATTTGAAGTCTATGAGTCACTCGCTCCCTATACAAAGGCTAGATTTTTAAATGAGCCTGGAAAGAAAACGCCTGTATTTGTCCGTTTTTCTACAGTCGCTGGTTCTCGCGGATCA
GGGGATTTAGCACGTGATGTCCGCGGGTTTGCAACAAAATTCTATACAGAAGAAGGGAATTATGATCTGGTTGGAAATAATATGCCTGTCTTCTTTATTCAGGATGGCATTAAATTCCCC
GACTTTATCCATGCAGTTAAGCCAGAACCGCACAACGAGATTCCTCAGGCACAGTCTGCACACGATACATTCTGGGATTTTGTGGCCAATAATCAGGAAACGGCCCATATGGTCATGTGG
CACATGTCAGACCGTGCTATCCCAAGAAGCTTCCGGATGATGGAAGGGTTTGGAGTACATACATACCGCTTAGTCAATGAAAAAGGACAAGCCTTCTTTGTGAAATTCCACTGGAAACCA
GTGCTTGGTGTGCATTCTGTTGTGTGGGATGAAGCACAAAAGATTAGCGGAAAAGATCCAGACTTCCACCGCCGTGATTTATATGAAGCAATTGAAAATGGCGATTATCCTGTCTATGAG
CTGGGCTTGCAAATTATTAATGAAGAAGATGAATTTAAATTCGATTTTGATATTCTCGACGCAACGAAACTCTGGCCAGAAGAAGATGTCCCAGTACAAATTGTCGGTAAAATGACACTA
AACCGAAATGTGGATAATTACTTTGCTGAAACGGAGCAAGTAGCCTTCCATCCCGGACATGTTGTTCCAGGTATTGACTTTAGTAATGATCCACTCTTACAGACACGTCTATTCTCTTAC
ACGGATACTCAGCTGATTCGTCTGGGTGGACCGAATTTCCATGAACTTCCGATTAATAGACCGGTTGCCCAATTCCACAACAACCAGCGGGATGGCTTTGGACGCCAGACCATTAATACG
AGTAAGGTGAGCTATTATAAGAATTCTCTGGCTCAAAATACACCAGGACCGGTCAGCGAGGAGGAGGGAGGATTCAGCCATTACCAGGAAAAAGTGGAAGGCCGCAAAGTCCGCGCTCGC
AGTGAAAGCTTTAAAGACCACTTCTCCCAAGCCATTCTTTTCTGGAATAGTATGAGCAATGTGGAGAAACAGCATATCATTAATGCATTCAGTTTTGAGCTTGGAAAATGTAAAGAAGTA
TCTGTACGCGAGCAAGTTTTAGAAATGTTCTCGAATGTTAACCATGAGCTGGTAACTAAGATTGCAGAAAATCTCGGTCTGCCTGTTCCTATGAAAAAGGAAATAACTTATGCAAAATCC
TCACCAGCCCTAAGTCAGGAAAACACCATCAAGAAAACTAATACACGCAAGGTAGCTGTCATTGCAGCAGACGGATATCCTAAAGAATTGTCTGCAATGATTAAAGAATTAAAATCTATT
GGCGCAAACGTTGAGATTGTAAGTGATCATCAAGGCACCATTCAAGGTAGTGACAACACGCAACTTCCAGTTGATCACACACTGATGACCGCAGATTCAGTTCTGTTTGATGCCGTTCTG
ATTGCCAACCAAAATGGTAAAACTCCATTATTCGGTAAAGAAGCACCTTATTTTGTCAAGGAGGCGCTCCTGCATTACAAACCAATCGGAGCGATAAAGGAAGGAGCCGTAATTCTAGAG
GACTTGCAAATTTCTGGACAAGATGGTGTAGTCATTGATGACAGCCAGCAATTTATAGAAGCTGTTCGTAAAGCTAGATTCTGGGATCGTGAAGGTAAAAACTAA
Retrieve as FASTA  
 

<< Back