The peroxidase database
Entry information :
Entry ID 6772
Creation 2009-05-10 (Christophe Dunand)
Last sequence changes 2009-05-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information
Name BdeNOx03
Class Ancestral NADPH oxidase    [Orthogroup: N/D]
Taxonomy Eukaryota Fungi Chytridiomycota Chytridiomycetes Batrachochytrium External Link
Organism Batrachochytrium dendrobatidis    [TaxId: 109871]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdeNOx03
start..stop
S start..stop
LbraFRe01 118 4e-28 112..453 438..766
PcarNOx01 114 3e-27 165..535 132..559
PcNOx01 112 1e-26 181..535 155..559
LbiNOx01 111 3e-26 181..535 155..559
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 638666..638774 109 N° 2 638027..638534 508 N° 3 637206..637897 692 N° 4 636938..637138 201
N° 5 636711..636814 104  
complement(join(636711..636814,636938..637138,637206..637897,638027..638534,6386 66..638774))


exon

Literature and cross-references
Literature
DNA ref. JGI genome: scaffold_10 (638774..636711)
mRNA ref. JGI transcript: 90468
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid537
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
59646.29 Transmb domain %sTransmembrane domain
Calculation done with TMHMM
The topology is given as the position of the transmembrane helices
separated by i if the loop is on the inside or o if it is on the outside.
For example i7-29o44-66i87-109o means that it starts on the inside,
has a predicted TMH at position 7 to 29, the outside, then a TMH at position 44-66 etc.
o15-37i58-80o95-114i127-149o169-191i198-220o
PI (ph)%sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
8.07
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALLYNKSHLEAATVYALLVSLLVAIGILPWKRLFSGNANNAFLRLCNTCSLSTMPVWPYYSLPDIVLVVVYIVITALFSVTTISTLDDIDFPRFGYLALANLSVLTLLPLRNSPLSAILGISYERCLLFHALLGVVACLCSLFHGSLYLYMWGSASFLVESINSRAMIPYGLAAGSLFGLVFLTSAIPLVRRISFELFYWIHILSYPTVLVLLYFHTAQSPQFFIPGAVLYGLDRILRIVRALRPANIVDSCAVDNDMIRLTLFQPSFLGKMEKARAGQFVFIKIPDITPYEWHPFSIISPEIDFAAKNQQETAQSIELLEANSEIGSRLSDDSTPSQRETLKPELCELAIRKKGFFTKELHQFISSRRALSVFVDGPYGRAFDGVMDRDTVLLVAGGIGITPLLSILRTIMHRNQHALTGDRKQVGLVWVTRNDHFNWFTAELTKAVSCGIQVHLHATCTYQELTQKTRSLPASVEYCKPDILSLMQGLQHRPNHNVSVAVCGPQSLVLSVEQAARRATSSDGMFVVFSETFSL


Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns). No EST.
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTACTGTATAACAAGAGTCATTTAGAAGCTGCAACTGTTTATGCTCTGCTAGTCAGTCTTTTAGTGGCCATTGGCATTCTACCATGGAAACGGCTTTTTTCAGGTATATTCCAC
TGCATCAAATATAAAGTGACAGCAAAGTCTTTGCAGCAAGCCTTGCAAATGCAGTTGAATAGACTTCCGAATTGAGCCGTGTGCATCTGATGATACTGTACTAACTTTTTACTTGGATAG

GCAATGCAAACAATGCATTTTTGCGATTATGCAACACATGCTCGCTATCGACTATGCCTGTATGGCCATACTATAGTTTGCCAGATATAGTGTTGGTGGTGGTCTATATTGTTATTACTG
CTCTGTTTTCCGTTACAACTATCAGTACATTGGATGACATTGATTTTCCTCGATTTGGATATCTGGCTCTTGCTAACCTATCAGTACTGACTCTGCTGCCACTTCGCAACTCTCCTCTGA
GTGCTATTTTGGGAATTTCCTATGAAAGATGCTTGCTGTTTCATGCCCTGCTTGGGGTTGTTGCATGTTTATGTTCTCTGTTCCATGGATCATTGTATCTATACATGTGGGGTTCGGCTT
CTTTTCTAGTCGAGTCAATCAACTCTCGAGCTATGATCCCATATGGTTTAGCAGCAGGGAGTTTATTTGGACTAGTATTCTTGACCAGTGCCATTCCGCTAGTTCGTCGTATTTCATTTG
AGTTGTTCTACTGGATCCATATTTTGAG
GTAATGTATTGTCTGCAACTCGACTTTTTTTGATGGTTGGTCTTGGTAGACTGACGAGGTTATAGTCAACTCACATTTCATTGACCTATTTG
TTCTGCAATCTTTATGGGTATATATTGTCTTTTAAAGCTATCCTACAGTCTTGGTTTTGCTCTACTTTCATACTGCTCAAAGTCCACAGTTTTTTATACCCGGAGCTGTTCTGTATGGAC
TTGATCGGATTTTACGAATTGTACGAGCACTTCGACCAGCCAACATTGTGGATTCGTGTGCTGTCGATAATGATATGATCCGCCTGACACTCTTTCAGCCATCGTTTTTAGGAAAGATGG
AAAAGGCAAGGGCTGGACAGTTTGTGTTTATCAAGATTCCAGATATAACTCCATATGAGTGGCATCCGTTCAGTATAATCTCGCCCGAGATTGATTTTGCAGCTAAAAATCAGCAGGAAA
CTGCACAGTCGATTGAACTTTTGGAGGCCAACAGTGAGATAGGCTCACGGTTGTCCGATGATTCTACACCGTCACAGCGAGAAACTCTCAAGCCAGAGTTGTGTGAGCTTGCTATTCGAA
AAAAAGGGTTTTTCACCAAAGAGTTGCATCAGTTCATTAGTAGTAGGAGAGCATTGAGTGTGTTTGTAGATGGACCATATGGACGAGCGTTTGATGGGGTCATGGATCGAGATACGGTTT
TACTTGTTGCTGGTGGTATTGGAATTACACCGTTACTGTCTATTTTGAGAACCATCATGCATCGTAATCAACATGCATTAACTGGTGATCGCAAGCAAGTTGGGCTGGTTTGGGTTACAC
GCAATCCAG
GTAATATAGACTTGACATGTATCGATTAGACTAGTACTTGACATTTTACAATGTATTTTAAAACCAGATCATTTTAACTGGTTTACCGCGGAGCTGACCAAGGCAGTTTCA
TGTGGTATTCAAGTTCATTTACATGCAACATGCACGTATCAAGAACTCACACAAAAAACAAGAAGCTTACCAGCTTCTGTAGAATATTGTAAACCAGATATTTTGAGCCTTATGCAAGGA
CTGCAACATAGGCCCAACCACAACGTATCAGTTGCAG
GTAAGAAGTGCAAGGTTTTCAGATATCAAGAGTTTTATAGATGGGATTGTACTGACAGCAACTTTATTTGATACAACTATGAC
GGATAAATCCAAACCCTTGACACCTGCTGTTTTCTATTAGTGTGTGGACCACAGTCTCTTGTTCTGTCAGTAGAACAGGCAGCACGTAGAGCCACCAGTTCCGATGGCATGTTTGTTGTG
TTTTCAGAGACCTTTTCTCTGTAG
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTACTGTATAACAAGAGTCATTTAGAAGCTGCAACTGTTTATGCTCTGCTAGTCAGTCTTTTAGTGGCCATTGGCATTCTACCATGGAAACGGCTTTTTTCAGGCAATGCAAAC
AATGCATTTTTGCGATTATGCAACACATGCTCGCTATCGACTATGCCTGTATGGCCATACTATAGTTTGCCAGATATAGTGTTGGTGGTGGTCTATATTGTTATTACTGCTCTGTTTTCC
GTTACAACTATCAGTACATTGGATGACATTGATTTTCCTCGATTTGGATATCTGGCTCTTGCTAACCTATCAGTACTGACTCTGCTGCCACTTCGCAACTCTCCTCTGAGTGCTATTTTG
GGAATTTCCTATGAAAGATGCTTGCTGTTTCATGCCCTGCTTGGGGTTGTTGCATGTTTATGTTCTCTGTTCCATGGATCATTGTATCTATACATGTGGGGTTCGGCTTCTTTTCTAGTC
GAGTCAATCAACTCTCGAGCTATGATCCCATATGGTTTAGCAGCAGGGAGTTTATTTGGACTAGTATTCTTGACCAGTGCCATTCCGCTAGTTCGTCGTATTTCATTTGAGTTGTTCTAC
TGGATCCATATTTTGAG
CTATCCTACAGTCTTGGTTTTGCTCTACTTTCATACTGCTCAAAGTCCACAGTTTTTTATACCCGGAGCTGTTCTGTATGGACTTGATCGGATTTTACGAATT
GTACGAGCACTTCGACCAGCCAACATTGTGGATTCGTGTGCTGTCGATAATGATATGATCCGCCTGACACTCTTTCAGCCATCGTTTTTAGGAAAGATGGAAAAGGCAAGGGCTGGACAG
TTTGTGTTTATCAAGATTCCAGATATAACTCCATATGAGTGGCATCCGTTCAGTATAATCTCGCCCGAGATTGATTTTGCAGCTAAAAATCAGCAGGAAACTGCACAGTCGATTGAACTT
TTGGAGGCCAACAGTGAGATAGGCTCACGGTTGTCCGATGATTCTACACCGTCACAGCGAGAAACTCTCAAGCCAGAGTTGTGTGAGCTTGCTATTCGAAAAAAAGGGTTTTTCACCAAA
GAGTTGCATCAGTTCATTAGTAGTAGGAGAGCATTGAGTGTGTTTGTAGATGGACCATATGGACGAGCGTTTGATGGGGTCATGGATCGAGATACGGTTTTACTTGTTGCTGGTGGTATT
GGAATTACACCGTTACTGTCTATTTTGAGAACCATCATGCATCGTAATCAACATGCATTAACTGGTGATCGCAAGCAAGTTGGGCTGGTTTGGGTTACACGCAATCCAG
ATCATTTTAAC
TGGTTTACCGCGGAGCTGACCAAGGCAGTTTCATGTGGTATTCAAGTTCATTTACATGCAACATGCACGTATCAAGAACTCACACAAAAAACAAGAAGCTTACCAGCTTCTGTAGAATAT
TGTAAACCAGATATTTTGAGCCTTATGCAAGGACTGCAACATAGGCCCAACCACAACGTATCAGTTGCAG
TGTGTGGACCACAGTCTCTTGTTCTGTCAGTAGAACAGGCAGCACGTAGA
GCCACCAGTTCCGATGGCATGTTTGTTGTGTTTTCAGAGACCTTTTCTCTGTAG
Retrieve as FASTA  
 

<< Back