The peroxidase database
Entry information :
Entry ID 6773
Creation 2009-05-10 (Christophe Dunand)
Last sequence changes 2009-05-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information
Name BdeFRe01
Class Ferric Reductase    [Orthogroup: FRe001]
Taxonomy Eukaryota Fungi Chytridiomycota Chytridiomycetes Batrachochytrium External Link
Organism Batrachochytrium dendrobatidis    [TaxId: 109871]
Cellular localisation N/D
Tissue type N/D
Inducer Abscissic acid treatment
Repressor N/D
Best BLASTp hits
Perox score E-value BdeFRe01
start..stop
S start..stop
PplNOx02-1A 90 4e-19 220..525 172..527
PplNOx02-1B 89 1e-18 220..525 172..527
BdeNOx02 88 1e-18 220..523 122..452
DdNOx01 86 7e-18 273..488 160..399
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 369516..370077 562 N° 2 370203..371851 1649  
join(369516..370077,370203..371851)


exon

Literature and cross-references
Literature
DNA ref. JGI genome: scaffold_3 (369516..371851)
mRNA ref. JGI transcript: 87228
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid737
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
82501.31 Transmb domain %sTransmembrane domain
Calculation done with TMHMM
The topology is given as the position of the transmembrane helices
separated by i if the loop is on the inside or o if it is on the outside.
For example i7-29o44-66i87-109o means that it starts on the inside,
has a predicted TMH at position 7 to 29, the outside, then a TMH at position 44-66 etc.
i21-43o63-82i143-165o180-202i229-251o271-289i296-318o451-473i571-593o624-646i
PI (ph)%sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
9.51
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGVIAASPRKPILSPTVVRLAARILATLAMLVALVASYALASMVEGGKLRWSSSIMVVDRFDQWILGFALLPMFIATLSTFFSDPNTPDSIVTGRNDEYTISADGRSSTAHSTPLHCSGFWNPRFKFLGKYSTLFKPWSQGDIMITCLLVISNILWWIAPVITRLYLKPSKTLSTPRGMLARFAIWAAMAGLWNAAMAIVFVVRENHITKNIVGKDAGQFHRGLRYHIALGYTSFVQITFHGTYYLTIMVIDGAFPNEILPTLSDTGYSNFFGFLAWLSLMLMALTSIFKVRRANYRIFYWTHQLYTCFLLFAFMHQTRTWYPVMASLVYFIFDRLLPRLKTQRTTSALLTRVSPSVVRLDIAILQTYADSCTYSPGSWVNILVPSISHFNWHPFSISSSHHLTPRTVTLYIKARGAWTTQLHASSTGLGVMVPIKMDGFFGSRNNSYLSYQHLVVVGAGTGIATIIPYIYSYAQHTLGKITVFWLARTAVEACAYRSLLEALSDPNSPLAGRVDLHLHLTREQDSRVSTKHDHRIGSGFNGNPNFASTLSKSVGYEQSSTTTKPSYRLSAIFLSIIVFSAAAVGYVIGRTYVPAYNADECNADEAYTLVGLSHFMCWYYPQWAPTGFACLFAAISGLAFVWMVSLMKQTDAAVSNVEPIDVTPASFEWFKERFTWVAHRPNFAYELESVFNFYNSIENQSNIKIAVIAGGPERMVRDIENVVIDHGQAFFRESWK


Retrieve as FASTA  
Remarks Complete sequence from genomic
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGTTATTGCTGCCAGTCCTCGCAAACCTATTTTATCACCAACTGTTGTTCGTCTAGCCGCCAGAATACTGGCTACGTTGGCCATGCTCGTGGCATTGGTGGCTTCTTACGCTTTA
GCATCAATGGTTGAAGGCGGAAAATTGCGCTGGAGTAGTTCCATTATGGTTGTGGATCGATTTGACCAATGGATTCTTGGATTCGCACTGTTACCCATGTTCATTGCCACACTATCTACC
TTTTTTAGCGATCCAAATACACCAGATTCTATAGTCACGGGAAGAAACGACGAGTACACAATATCTGCTGATGGTCGGTCTTCCACCGCCCACTCCACTCCACTTCATTGCTCTGGTTTC
TGGAATCCCCGTTTCAAATTCCTTGGTAAATACAGCACTCTTTTCAAACCATGGTCTCAAGGAGATATTATGATTACCTGTTTGCTTGTCATCTCCAATATTCTATGGTGGATTGCTCCT
GTGATTACTCGTCTGTATCTAAAACCCTCAAAAACACTTTCCACTCCCCGCGGCATGCTTGCTCGATTTGCAATTTGGGCCG
GTAAGTTTAAACATTTCACAAGCATATTCACCGTGTAG
CTGGATTTCAAGCTAGTGCATGTCCCTTTTCAACAGTACTAATTAAAAACTTGAACTGCTGCATACCTCTGTGATAAACATACATAGCCATGGCTGGTTTGTGGAATGCTGCAATGGCTA
TTGTATTTGTTGTTCGTGAGAATCATATTACCAAAAACATTGTTGGCAAGGATGCTGGCCAGTTTCATCGTGGTCTCCGATATCACATTGCCTTGGGATACACGAGCTTTGTCCAAATTA
CCTTTCATGGCACATATTACCTTACTATCATGGTGATAGATGGTGCTTTTCCCAATGAGATACTGCCAACTCTCAGTGACACTGGCTATTCCAACTTTTTTGGATTTCTAGCTTGGCTTT
CTTTGATGCTTATGGCTCTGACCTCTATCTTTAAAGTGCGTCGTGCCAACTACCGCATCTTTTATTGGACGCATCAGCTTTATACCTGTTTCCTGCTTTTTGCGTTCATGCACCAAACTA
GAACTTGGTATCCAGTTATGGCTTCACTCGTGTACTTTATCTTTGATCGGCTTTTACCTCGCCTTAAAACTCAGCGCACCACATCTGCTCTGCTCACTCGTGTTTCTCCGTCAGTAGTTC
GGCTGGATATTGCCATCTTGCAAACCTATGCAGATTCTTGTACATATTCTCCTGGCAGTTGGGTCAATATACTTGTTCCCTCAATTTCCCATTTCAATTGGCACCCATTTTCTATCTCCT
CCAGTCATCATCTTACTCCTCGCACCGTTACTCTATATATCAAGGCTCGAGGTGCATGGACTACGCAGCTGCACGCTTCGTCAACCGGCTTAGGTGTCATGGTTCCAATTAAGATGGACG
GATTTTTTGGGTCGCGCAACAACAGCTACTTGTCCTACCAACACCTTGTTGTTGTGGGTGCTGGAACTGGTATTGCTACTATAATCCCCTACATATACAGCTATGCCCAACATACTCTGG
GGAAAATCACGGTATTTTGGTTGGCTCGCACTGCTGTTGAAGCGTGCGCATATCGTTCTCTACTTGAAGCTCTCTCTGATCCCAATTCACCACTTGCTGGTCGTGTCGACTTGCATCTGC
ATTTGACTCGCGAGCAGGATTCTCGTGTATCTACTAAACACGACCATCGCATTGGATCCGGATTTAATGGAAACCCGAACTTTGCTTCCACCCTTTCTAAATCTGTTGGCTATGAACAAT
CAAGCACAACTACCAAACCATCCTACCGTTTGTCCGCCATTTTTCTTTCCATAATTGTATTTAGTGCTGCAGCTGTGGGATACGTTATTGGACGTACCTATGTTCCCGCATACAATGCCG
ATGAATGCAATGCCGACGAAGCATACACGCTTGTTGGACTTTCTCACTTTATGTGTTGGTATTATCCCCAATGGGCACCTACTGGATTTGCCTGTCTATTTGCTGCTATCAGTGGTCTTG
CCTTTGTATGGATGGTCTCACTAATGAAGCAAACTGATGCTGCTGTTTCAAACGTGGAGCCTATTGATGTCACTCCCGCATCTTTCGAGTGGTTCAAGGAACGCTTTACCTGGGTCGCTC
ATCGGCCAAACTTTGCCTATGAGCTTGAATCAGTGTTCAACTTTTATAATAGTATCGAGAATCAGTCTAACATTAAGATTGCTGTGATTGCCGGAGGTCCTGAGCGTATGGTTCGTGATA
TTGAAAATGTGGTGATTGATCACGGTCAAGCCTTTTTCCGCGAGTCTTGGAAAATG
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGTTATTGCTGCCAGTCCTCGCAAACCTATTTTATCACCAACTGTTGTTCGTCTAGCCGCCAGAATACTGGCTACGTTGGCCATGCTCGTGGCATTGGTGGCTTCTTACGCTTTA
GCATCAATGGTTGAAGGCGGAAAATTGCGCTGGAGTAGTTCCATTATGGTTGTGGATCGATTTGACCAATGGATTCTTGGATTCGCACTGTTACCCATGTTCATTGCCACACTATCTACC
TTTTTTAGCGATCCAAATACACCAGATTCTATAGTCACGGGAAGAAACGACGAGTACACAATATCTGCTGATGGTCGGTCTTCCACCGCCCACTCCACTCCACTTCATTGCTCTGGTTTC
TGGAATCCCCGTTTCAAATTCCTTGGTAAATACAGCACTCTTTTCAAACCATGGTCTCAAGGAGATATTATGATTACCTGTTTGCTTGTCATCTCCAATATTCTATGGTGGATTGCTCCT
GTGATTACTCGTCTGTATCTAAAACCCTCAAAAACACTTTCCACTCCCCGCGGCATGCTTGCTCGATTTGCAATTTGGGCCG
CCATGGCTGGTTTGTGGAATGCTGCAATGGCTATTGTA
TTTGTTGTTCGTGAGAATCATATTACCAAAAACATTGTTGGCAAGGATGCTGGCCAGTTTCATCGTGGTCTCCGATATCACATTGCCTTGGGATACACGAGCTTTGTCCAAATTACCTTT
CATGGCACATATTACCTTACTATCATGGTGATAGATGGTGCTTTTCCCAATGAGATACTGCCAACTCTCAGTGACACTGGCTATTCCAACTTTTTTGGATTTCTAGCTTGGCTTTCTTTG
ATGCTTATGGCTCTGACCTCTATCTTTAAAGTGCGTCGTGCCAACTACCGCATCTTTTATTGGACGCATCAGCTTTATACCTGTTTCCTGCTTTTTGCGTTCATGCACCAAACTAGAACT
TGGTATCCAGTTATGGCTTCACTCGTGTACTTTATCTTTGATCGGCTTTTACCTCGCCTTAAAACTCAGCGCACCACATCTGCTCTGCTCACTCGTGTTTCTCCGTCAGTAGTTCGGCTG
GATATTGCCATCTTGCAAACCTATGCAGATTCTTGTACATATTCTCCTGGCAGTTGGGTCAATATACTTGTTCCCTCAATTTCCCATTTCAATTGGCACCCATTTTCTATCTCCTCCAGT
CATCATCTTACTCCTCGCACCGTTACTCTATATATCAAGGCTCGAGGTGCATGGACTACGCAGCTGCACGCTTCGTCAACCGGCTTAGGTGTCATGGTTCCAATTAAGATGGACGGATTT
TTTGGGTCGCGCAACAACAGCTACTTGTCCTACCAACACCTTGTTGTTGTGGGTGCTGGAACTGGTATTGCTACTATAATCCCCTACATATACAGCTATGCCCAACATACTCTGGGGAAA
ATCACGGTATTTTGGTTGGCTCGCACTGCTGTTGAAGCGTGCGCATATCGTTCTCTACTTGAAGCTCTCTCTGATCCCAATTCACCACTTGCTGGTCGTGTCGACTTGCATCTGCATTTG
ACTCGCGAGCAGGATTCTCGTGTATCTACTAAACACGACCATCGCATTGGATCCGGATTTAATGGAAACCCGAACTTTGCTTCCACCCTTTCTAAATCTGTTGGCTATGAACAATCAAGC
ACAACTACCAAACCATCCTACCGTTTGTCCGCCATTTTTCTTTCCATAATTGTATTTAGTGCTGCAGCTGTGGGATACGTTATTGGACGTACCTATGTTCCCGCATACAATGCCGATGAA
TGCAATGCCGACGAAGCATACACGCTTGTTGGACTTTCTCACTTTATGTGTTGGTATTATCCCCAATGGGCACCTACTGGATTTGCCTGTCTATTTGCTGCTATCAGTGGTCTTGCCTTT
GTATGGATGGTCTCACTAATGAAGCAAACTGATGCTGCTGTTTCAAACGTGGAGCCTATTGATGTCACTCCCGCATCTTTCGAGTGGTTCAAGGAACGCTTTACCTGGGTCGCTCATCGG
CCAAACTTTGCCTATGAGCTTGAATCAGTGTTCAACTTTTATAATAGTATCGAGAATCAGTCTAACATTAAGATTGCTGTGATTGCCGGAGGTCCTGAGCGTATGGTTCGTGATATTGAA
AATGTGGTGATTGATCACGGTCAAGCCTTTTTCCGCGAGTCTTGGAAAATG
Retrieve as FASTA  
 

<< Back