The peroxidase database
Entry information :
Entry ID 7595
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2010-08-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information
Name AbHalPrx03_bisporus
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus External Link
Organism Agaricus bisporus    [TaxId: 5341]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbHalPrx03_bisporus
start..stop
S start..stop
AbHalPrx04_bisporus 699 0 1..374 1..375
LbiHalPrx05 499 4e-178 5..371 14..385
AbHalPrx05_bisporus 467 7e-166 1..371 1..370
AdelHalPrx01 365 1e-125 2..370 3..382
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 261078..261353 276 N° 2 260970..261027 58 N° 3 260726..260917 192 N° 4 260614..260666 53
N° 5 260019..260564 546  
complement(join(260019..260564,260614..260666,260726..260917,260970..261027,2610 78..261353))


exon

Literature and cross-references
Literature
DNA ref. JGI genome: scaffold_15 (261353..260019)
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid 374 (354)
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
40823.3 (38700.2)
PI (pH) %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
6.91 (6.91) Peptide Signal %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 21 range:21-374
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSLINFVALALACTWSALAFPPSYASLGGLPREELDRILPSLQYRSPGAPPGPLKFNGTKLVNDHQHPWKPLKHGDIRGPCPGLNTLASHGYLPRNGIATPAQIINAVQEGFNMENSVARLVVYAAHLVDGNLITDKLSIGGKSPLTGPSPQAPANAAGLNTHALFEGDASMTRADAFFGDNHSFNETLFDEFTAFSNRFGAGKYNLTVAAEYRFHRIQESIATNPNFSFVSPRFFTAYAESVFPINFFIDGRQGDGQLDLDVARGFFQNMHMPDGFHRARKPMGIEGLEIANVHPISPGANVNGVNTYTPDPSSADFTTFCLLYVNFVNQTVRSLYPNPTGNLKKALTKNLEFLYYPFSDQCSQVFPYGNDN


Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCAGCCTTATCAATTTCGTCGCTCTCGCACTTGCTTGCACTTGGTCTGCTCTAGCTTTTCCTCCATCATATGCTTCATTGGGAGGTTTGCCGAGAGAAGAATTGGACAGAATATTG
CCATCTCTCCAGTATCGCTCCCCGGGAGCTCCTCCTGGCCCTCTGAAATTCAATGGCACTAAGCTCGTCAATGACCACCAACACCCATGGAAACCTTTGAAACATGGTGACATTCGAGGG
CCATGTCCAGGATTGAATACGCTTGCTTCGCATGGA
GTTCGTTTCAATGATCTGTTGAATATATTTAGCCTAACCACTGTTCTTAGTATCTCCCCCGTAATGGTATTGCGACGCCTGCTC
AAATCATCAACGCCGTCCAGGAAG
GTGTGTAATGCGTGATTCATGTATATATCTTATAAATCAACATTCTCGCTAGGTTTCAACATGGAGAACAGTGTCGCGAGACTAGTAGTCTATGCT
GCCCATCTAGTTGATGGTAATCTCATCACAGACAAACTCAGCATCGGCGGGAAGAGTCCGTTGACTGGTCCTAGCCCACAGGCCCCAGCTAATGCGGCAGGTTTGAATACGCATGCTCTG
TTCGAGGGAGATGCAAGCATGACTCGAG
GTCCGTTGCGCGAACTATGCCACGTGTTAGGCAGCATTCTCACTGTCTTCCATATTCAGCGGATGCCTTTTTTGGTGACAACCACAGCTTCA
ACGAGACACTATTTGACGAG
GCCGGTCTTCTCTAATTTTGTATATTCAGCATGGCTGATGACTTCACAGTTTACTGCCTTCAGCAACCGATTCGGTGCCGGAAAATACAACCTTACGGTT
GCTGCGGAGTACCGATTTCATCGGATTCAAGAATCGATCGCGACGAATCCCAACTTTTCCTTCGTGTCGCCTCGATTTTTCACTGCTTATGCAGAGTCTGTGTTCCCCATCAATTTCTTC
ATAGATGGGCGCCAGGGAGATGGCCAATTGGACCTTGACGTTGCTCGTGGCTTCTTCCAGAACATGCACATGCCAGATGGGTTCCATAGGGCCCGTAAACCGATGGGGATTGAGGGCCTC
GAAATCGCTAACGTTCACCCCATTTCTCCTGGTGCCAATGTCAACGGGGTTAATACTTATACTCCTGATCCCAGCTCCGCTGACTTCACAACCTTCTGTCTGTTGTATGTGAATTTTGTA
AATCAAACCGTGCGCAGTCTTTACCCGAACCCAACTGGTAATTTGAAGAAGGCGCTCACCAAGAATTTGGAATTCTTATATTACCCATTCAGCGATCAATGTTCTCAAGTTTTTCCTTAT
GGAAATGACAATTGA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCAGCCTTATCAATTTCGTCGCTCTCGCACTTGCTTGCACTTGGTCTGCTCTAGCTTTTCCTCCATCATATGCTTCATTGGGAGGTTTGCCGAGAGAAGAATTGGACAGAATATTG
CCATCTCTCCAGTATCGCTCCCCGGGAGCTCCTCCTGGCCCTCTGAAATTCAATGGCACTAAGCTCGTCAATGACCACCAACACCCATGGAAACCTTTGAAACATGGTGACATTCGAGGG
CCATGTCCAGGATTGAATACGCTTGCTTCGCATGGA
TATCTCCCCCGTAATGGTATTGCGACGCCTGCTCAAATCATCAACGCCGTCCAGGAAGGTTTCAACATGGAGAACAGTGTCGCG
AGACTAGTAGTCTATGCTGCCCATCTAGTTGATGGTAATCTCATCACAGACAAACTCAGCATCGGCGGGAAGAGTCCGTTGACTGGTCCTAGCCCACAGGCCCCAGCTAATGCGGCAGGT
TTGAATACGCATGCTCTGTTCGAGGGAGATGCAAGCATGACTCGAG
CGGATGCCTTTTTTGGTGACAACCACAGCTTCAACGAGACACTATTTGACGAGTTTACTGCCTTCAGCAACCGA
TTCGGTGCCGGAAAATACAACCTTACGGTTGCTGCGGAGTACCGATTTCATCGGATTCAAGAATCGATCGCGACGAATCCCAACTTTTCCTTCGTGTCGCCTCGATTTTTCACTGCTTAT
GCAGAGTCTGTGTTCCCCATCAATTTCTTCATAGATGGGCGCCAGGGAGATGGCCAATTGGACCTTGACGTTGCTCGTGGCTTCTTCCAGAACATGCACATGCCAGATGGGTTCCATAGG
GCCCGTAAACCGATGGGGATTGAGGGCCTCGAAATCGCTAACGTTCACCCCATTTCTCCTGGTGCCAATGTCAACGGGGTTAATACTTATACTCCTGATCCCAGCTCCGCTGACTTCACA
ACCTTCTGTCTGTTGTATGTGAATTTTGTAAATCAAACCGTGCGCAGTCTTTACCCGAACCCAACTGGTAATTTGAAGAAGGCGCTCACCAAGAATTTGGAATTCTTATATTACCCATTC
AGCGATCAATGTTCTCAAGTTTTTCCTTATGGAAATGACAATTGA
Retrieve as FASTA  
 

<< Back