The peroxidase database
Entry information :
Entry ID 7596
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2010-08-17 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information
Name AbHalPrx04_bisporus
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus External Link
Organism Agaricus bisporus    [TaxId: 5341]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbHalPrx04_bisporus
start..stop
S start..stop
AbHalPrx03_bisporus 717 0 1..375 1..374
LbiHalPrx05 509 0 5..373 14..386
AbHalPrx05_bisporus 466 2e-165 1..373 1..371
AdelHalPrx01 361 4e-124 2..371 3..382
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3085620..3085895 276 N° 2 3085951..3086008 58 N° 3 3086067..3086258 192 N° 4 3086318..3086370 53
N° 5 3086420..3086968 549  
join(3085620..3085895,3085951..3086008,3086067..3086258,3086318..3086370,3086420 ..3086968)


exon

Literature and cross-references
Literature
DNA ref. JGI genome: scaffold_2 (3085620..3086968)
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid 375 (355)
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
40803.27 (38650.2)
PI (pH) %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
6.42 (6.42) Peptide Signal %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 21 range:21-375
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSLLNFVTLALACTWSALAFPSSYTSLGGLPREELDRILPSLQYRSPGAPPGPLKFNGTKLVNDDQHPWKPLKHGDMRGPCPGLNTLASHGYLPRNGIATPVQIINAVQEGFNMENSVARLVTYAAHLVDGNLVTDKLSIGGKSPLTGPSPPAPANAAGLNTHALFEGDVSMTRADAFFGDNHSFNETLFDEFTAFSNQFGAGKYNLTVAAEYRFHRIQESIATNPNFSFVSPRFFTAYAESVFPINFFIDGRQGDGQLDLDVARGFFQNMRMPDGFHRASIPTGLEGLAEIASVHPISPGANVNGVNTYTFDPSSADFTTFCLLYVNFVNQTVRSLYPEPTGNLKKALKKNLEFLYGPFSDQCSQVFPYGKDN


Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTAGCCTTCTCAATTTCGTCACTCTCGCGCTTGCTTGCACTTGGTCTGCTCTTGCTTTTCCTTCATCATATACTTCATTGGGCGGTTTGCCCAGAGAAGAATTGGACAGAATATTG
CCATCCCTCCAGTATCGCTCCCCGGGAGCTCCTCCTGGTCCTCTGAAATTCAATGGCACTAAGCTCGTCAACGACGACCAACACCCGTGGAAACCTTTGAAACATGGTGACATGCGAGGG
CCATGCCCAGGATTGAATACGCTTGCTTCGCATGGA
GTTAGTTTGAATGTTTGAAGCCGTTGAATATATTTAGTCTAACCATCGTTCTCAGTATCTCCCTCGTAATGGTATTGCGACGCC
TGTTCAAATCATCAACGCCGTTCAGGAAG
GTGTGTAATATATAATTCAAATATATATCTTATCCCCATAAATTAACATCCTCACTAGGTTTTAACATGGAGAACAGTGTCGCGAGATTAG
TAACCTATGCTGCCCATCTGGTTGATGGTAATCTTGTCACAGACAAACTCAGCATCGGCGGAAAGAGTCCGTTGACTGGTCCTAGCCCACCGGCCCCAGCTAATGCGGCAGGTTTGAATA
CGCATGCTCTGTTCGAGGGAGATGTAAGCATGACTCGAG
GTCCGTTGCGCGAACTATGCCACATGTTAAATAGCATTCTAATCGTCATCCATGCTCAGCGGATGCCTTCTTTGGTGACAA
CCACAGCTTCAACGAGACACTATTTGACGAG
GCGGGTCTTTTCTAATTTCGTAGTTTCACCATCACTGACGACTTTACAGTTTACTGCCTTCAGCAACCAATTCGGTGCCGGAAAATACA
ACCTTACGGTCGCTGCGGAGTACCGATTTCATCGGATTCAAGAATCTATCGCGACAAATCCCAACTTTTCCTTTGTGTCCCCTCGGTTTTTCACTGCTTATGCCGAGTCCGTGTTCCCCA
TCAATTTTTTCATAGATGGGCGTCAGGGAGATGGCCAATTGGATCTTGACGTTGCTCGTGGCTTCTTCCAGAACATGCGGATGCCAGATGGATTCCATCGGGCCAGTATACCGACGGGGC
TTGAGGGCCTCGCCGAAATCGCTAGCGTTCACCCCATTTCCCCCGGTGCCAATGTCAACGGGGTCAATACTTATACTTTTGATCCCAGCTCCGCTGACTTCACAACCTTCTGTCTGTTGT
ACGTGAATTTTGTAAACCAGACCGTGCGCAGTCTCTACCCAGAACCAACTGGTAATTTAAAGAAGGCGCTCAAAAAGAATTTGGAATTCTTATATGGCCCATTCAGCGATCAATGTTCCC
AAGTTTTTCCTTATGGAAAGGACAATTGA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTAGCCTTCTCAATTTCGTCACTCTCGCGCTTGCTTGCACTTGGTCTGCTCTTGCTTTTCCTTCATCATATACTTCATTGGGCGGTTTGCCCAGAGAAGAATTGGACAGAATATTG
CCATCCCTCCAGTATCGCTCCCCGGGAGCTCCTCCTGGTCCTCTGAAATTCAATGGCACTAAGCTCGTCAACGACGACCAACACCCGTGGAAACCTTTGAAACATGGTGACATGCGAGGG
CCATGCCCAGGATTGAATACGCTTGCTTCGCATGGA
TATCTCCCTCGTAATGGTATTGCGACGCCTGTTCAAATCATCAACGCCGTTCAGGAAGGTTTTAACATGGAGAACAGTGTCGCG
AGATTAGTAACCTATGCTGCCCATCTGGTTGATGGTAATCTTGTCACAGACAAACTCAGCATCGGCGGAAAGAGTCCGTTGACTGGTCCTAGCCCACCGGCCCCAGCTAATGCGGCAGGT
TTGAATACGCATGCTCTGTTCGAGGGAGATGTAAGCATGACTCGAG
CGGATGCCTTCTTTGGTGACAACCACAGCTTCAACGAGACACTATTTGACGAGTTTACTGCCTTCAGCAACCAA
TTCGGTGCCGGAAAATACAACCTTACGGTCGCTGCGGAGTACCGATTTCATCGGATTCAAGAATCTATCGCGACAAATCCCAACTTTTCCTTTGTGTCCCCTCGGTTTTTCACTGCTTAT
GCCGAGTCCGTGTTCCCCATCAATTTTTTCATAGATGGGCGTCAGGGAGATGGCCAATTGGATCTTGACGTTGCTCGTGGCTTCTTCCAGAACATGCGGATGCCAGATGGATTCCATCGG
GCCAGTATACCGACGGGGCTTGAGGGCCTCGCCGAAATCGCTAGCGTTCACCCCATTTCCCCCGGTGCCAATGTCAACGGGGTCAATACTTATACTTTTGATCCCAGCTCCGCTGACTTC
ACAACCTTCTGTCTGTTGTACGTGAATTTTGTAAACCAGACCGTGCGCAGTCTCTACCCAGAACCAACTGGTAATTTAAAGAAGGCGCTCAAAAAGAATTTGGAATTCTTATATGGCCCA
TTCAGCGATCAATGTTCCCAAGTTTTTCCTTATGGAAAGGACAATTGA
Retrieve as FASTA  
 

<< Back