The peroxidase database
Entry information :
Entry ID 7602
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2010-08-17 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information
Name AbHalPrx02_bisporus
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus External Link
Organism Agaricus bisporus    [TaxId: 5341]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbHalPrx02_bisporus
start..stop
S start..stop
LbiHalPrx04 321 6e-112 11..267 5..251
CcinHalPrx03 296 6e-102 20..263 13..260
SbreHalPrx03 228 3e-75 20..263 17..247
SlutHalPrx03 224 9e-74 20..263 13..243
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 205920..206095 176 N° 2 205237..205870 634  
complement(join(205237..205870,205920..206095))


exon

Literature and cross-references
Literature
DNA ref. JGI genome: scaffold_18 (206095..205237)
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid269
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
29849.99
PI (ph)%sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
6.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPSSLLSNKISLPDAHPPVHEHSSGRCPVADKHDFCPPQSGDSRSPCPALNTMANHGYINRDGKNVSAYDIHRGLKACYGLSTPLALFLSYVGFAMLRRARPIDLYQIGKHNVIEHDASLVHHDTPGGEEYAPIKIDEALVEELIEDVSGGHEAAKSEEPTPQSSLMDAVDVARSRVRREKLSKPLDPVHAEIARGEMAIILGVWEQKSKDKVGVPIDWMKQWLGHERLPDGWRPDHTEGLFDVIRRAKEMRAVMERMQEEEALLSKAS


Retrieve as FASTA  
Remarks Complete sequence from genomic (1 introns)
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTCTTCCCTTCTCTCCAACAAAATATCCCTCCCCGACGCTCACCCTCCTGTGCACGAGCATAGTAGCGGAAGATGTCCCGTTGCTGATAAACACGACTTCTGTCCTCCTCAGTCC
GGTGACAGCCGTTCACCTTGCCCTGCTCTAAATACTATGGCAAATCATGGTTATAT
GTATGTGTTGCCTTTTAATCATAAAATGCCCTTTCCTAAATTCTCGTAGTAATCGTGATGGAAA
AAATGTTTCGGCGTATGACATCCATCGTGGGTTGAAAGCATGTTACGGGCTTTCAACGCCACTTGCACTCTTCTTGAGCTACGTTGGCTTCGCTATGTTGCGGCGTGCGCGTCCAATCGA
CCTTTATCAAATCGGAAAGCACAATGTGATAGAACATGATGCTAGTCTTGTTCATCACGATACTCCCGGAGGGGAAGAATATGCACCAATCAAGATTGATGAGGCGCTTGTAGAAGAGTT
GATCGAAGATGTGAGCGGCGGCCATGAAGCAGCAAAGTCCGAAGAACCGACGCCACAATCGTCGCTCATGGATGCCGTTGATGTGGCACGTTCTCGTGTTAGGCGTGAGAAATTATCTAA
ACCTTTGGACCCGGTACATGCAGAAATTGCTCGGGGGGAAATGGCTATCATCCTCGGTGTATGGGAACAAAAGTCGAAAGATAAAGTCGGAGTGCCAATCGATTGGATGAAGCAGTGGCT
TGGCCACGAGCGATTGCCCGATGGTTGGAGACCTGATCACACCGAGGGTTTGTTCGACGTAATCAGACGTGCCAAAGAGATGAGAGCGGTCATGGAAAGGATGCAGGAGGAGGAAGCACT
TCTATCAAAGGCCTCGTGA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTCTTCCCTTCTCTCCAACAAAATATCCCTCCCCGACGCTCACCCTCCTGTGCACGAGCATAGTAGCGGAAGATGTCCCGTTGCTGATAAACACGACTTCTGTCCTCCTCAGTCC
GGTGACAGCCGTTCACCTTGCCCTGCTCTAAATACTATGGCAAATCATGGTTATAT
TAATCGTGATGGAAAAAATGTTTCGGCGTATGACATCCATCGTGGGTTGAAAGCATGTTACGGG
CTTTCAACGCCACTTGCACTCTTCTTGAGCTACGTTGGCTTCGCTATGTTGCGGCGTGCGCGTCCAATCGACCTTTATCAAATCGGAAAGCACAATGTGATAGAACATGATGCTAGTCTT
GTTCATCACGATACTCCCGGAGGGGAAGAATATGCACCAATCAAGATTGATGAGGCGCTTGTAGAAGAGTTGATCGAAGATGTGAGCGGCGGCCATGAAGCAGCAAAGTCCGAAGAACCG
ACGCCACAATCGTCGCTCATGGATGCCGTTGATGTGGCACGTTCTCGTGTTAGGCGTGAGAAATTATCTAAACCTTTGGACCCGGTACATGCAGAAATTGCTCGGGGGGAAATGGCTATC
ATCCTCGGTGTATGGGAACAAAAGTCGAAAGATAAAGTCGGAGTGCCAATCGATTGGATGAAGCAGTGGCTTGGCCACGAGCGATTGCCCGATGGTTGGAGACCTGATCACACCGAGGGT
TTGTTCGACGTAATCAGACGTGCCAAAGAGATGAGAGCGGTCATGGAAAGGATGCAGGAGGAGGAAGCACTTCTATCAAAGGCCTCGTGA
Retrieve as FASTA  
 

<< Back