The peroxidase database
Entry information :
Entry ID 84
Creation 2006-01-26 (Filippo Passardi)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-12 (Achraf Jemmat)
Peroxidase information
Name (synonym) AtPrx08 (At1g34510 / PER8)
Class Class III peroxidase    [Orthogroup: Prx025]*
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis External Link
Organism Arabidopsis thaliana    [TaxId: 3702]
Cellular localisation N/D
Tissue type Roots
Inducers Hormon treatment
Stress treatment
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx08
start..stop
S start..stop
AtPrx[P]08 448 2e-160 1..305 1..308
BrPrx44-2Ab_other 440 2e-157 1..310 1..310
CagraPrx21 437 3e-156 1..310 1..310
AlyPrx44-1 437 5e-156 1..310 1..310
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12616752..12616952 201 N° 2 12615928..12616659 732  
complement(join(12615928..12616659,12616752..12616952))


exon

Literature and cross-references
Literature
Protein ref. UniProtKB: Q9LNL0
DNA ref. Phytozome 11: Chr1 (12616952..12615928)
mRNA ref. GenBank: NM_103173
Cluster/Prediction ref. Phytozome Gene 11: 19656811 UniGene: At.39717
Omic ref. TAIR: At1g34510
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid 310 (290)
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
34195.55 (31862.4)
PI (pH) %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
9.54 (9.56) Peptide Signal %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 21 range:21-310
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRAIAAWFFIFCYLVPSVFAQLRHGFYEGTCPPAESIVGRVVFNHWDRNRTVTAALLRMQFHDCVVKGCDASLLIDPTTERPSEKSVGRNAGVRGFEIIDEAKKELELVCPKTVSCADIVTIATRDSIALAGGPKFKVRTGRRDGLRSNPSDVKLLGPTVSVATSIKAFKSIGFNVSTMVALIGGGHTVGVAHCSLFQDRIKDPKMDSKLRAKLKKSCRGPNDPSVFMDQNTPFRVDNEIYRQMIQQRAILRIDDNLIRDGSTRSIVSDFAYNNKLFKESFAEAMQKMGEIGVLTGDSGEIRTNCRAFNN*


Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, intron 1), 2 cDNA and 6 ESTs (5 from roots only).
Promoter +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGACATTGTA AATAAGTTCA AATACAAAAT TTATTTATTT AAACAAAAAA CGTTTAGTAA GAATAATATT TATTTAACAA AAAACTTTGT TTTAAAATAT TGTTAGCAAA TATGTTTATG  CTAATTTTAA GGGATTAATT TGAAGTTTGT TGGGATTAAA TTTGATTGAT AATGTGATTG ACAATTTAAA TCAAAAATTT AAAGTAAAAT TAATTATTTT GAAAAAAAGA TTTAACGCTA  ATGGCATTAG ATTGTAAATA AGTGTCAAGT AGAGGATTTA TTTGCTAAAA TGGCTGCAAA AATGTATATA TAGATATGTA GTAATTTTAT AGTTTGATGA CTATTTTTCT AAATATAAGA  TATATCTATT AATAAATTAT TTTAGTCAAA TTATAATTAA TGATAAGTAC ACGTGTCATC AAAGTAGAGT GTCAAATATC TCATTGGTAG GCAAAGTTAG AAAAAACCTT CTAAGATTTT  AATGGCTTTT GCCTACATCA AATAAAGTTA ATATCGATGG CCTACATATC AGGAGAAAAA ACTATGACTT ATCATCGCGG AATTTTACAA TCTGGAAACA GATCTTATGA GATGCAAGTT  TTAGCCACAA TCTCCAACTA AACAAAAATT TCATCAACTA ACTTTGCTTT AACCGATAGG CATAGCTGGC GCTAACTCAT GTAAAGCTAC AAGAAAAAAG AAAGAAAAAA GAAAGAAAAT  AAACAAGGGC TGCATGAGTA TACAAATAAT TGATAAGTTC TTAACCATGA TTGAACCAGA GAAGACATGG TCAAAGAGAA AAGAAGAATT GATAAGTGCG TTCCTTTAGG AGATCAAGCT  CCATGTTTCC ATATTCCCAC TTTGTTAATT ATGTTCTTTG TTAAAGACAT CGAAGTCATG AGAAGGAACT AGACTTGAAG ATTGACAAAA CAGAGTTTAT CTCTTTAGTT ATTTTGTGTG  TTCTTGTGTT AAGACAAAAC ACATCTCTTT GGCTTTGAGG AGAGACCACC TATCAATAAT ATCAAGAATA TGAAATTTTG GCTTCGACCA AATAAGTCCA GCACTTATCA CTACTCCTAC  GCTCTAGATT AAATCTCCAA TTAAGCTCCT TGTAGATTGC TATAGGCGGA ACATATATAT TTTATGTTAT GACAAATTTA ATTTATGTCA TGACAGATTT ATTTAAGGTT ATCAAACTGT  GGCTTTTGAT AGCAGATTTG ATAATGAAAG AAGAAACAAC TCCAAAGAAC TTTATAGTAA AAATATTTGC ATATATATCA TCAGGTGTTG AATGGTTGCG TAGTATGATG TAGACCGGAC  TAAAATCGGA CCAGCCGGCA CTTAATTCAT CATTCACTAT TGCGGACTAA AGTGCACTAA TGCAGACTAA AAATCTCCAC ACTACCATGC ACATGAGCAT ACAACTCCAT ACCATCACAA  ATTCACTACT AGTCTGCAGT TTTTCACTCC ACTTCCCAAA AACTCCATAC CATCATCAAC TTCATACCAA CATATTATTA TCTGCTGCAT ACTACAGTAC GACATTTTGC ATACTAAAAT  ATTGGTAAGT ATTATCTAGT CCGCATTATA TAAATAACCA TTCAAAGCCT CAATCTTTTG ACAAGTAGAT TGACGATCTT ATAATATATT TTTATACAAC ATTGATGAAC CACACTATTG  CAAGATATAA CTTTAAAAAT CATCGCTTGC CAGTGTTATA CCATTACCCT TTGGCACGTT TTCGAAATGT AACAATGTCT TGTCCCCATA TTTTTTATAC AACATTGATG AACCACACTA  TCACAAGATA TAATTTTTTA AACCTTTATT CTCTGCACGT CTTCGAAGTG AAACAATTTC TTTGCCAATG TCTTGTCCCC ATATTTACGT ATAAATATGC ATTTTACGGG CACTAATTAA  CCATTTCATC ACCAAAACTT AAAACTAAAC ACAATCCAAA AGTATTTTTA AGCTTTCACA TACGAGAGAA AACTTAGAAA 
Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGATCTCTAT TCTACATACA TTTTGTTGGA ACTATGATCA AATCTCGCTT CTGCGTATTC GTCTTTTTCT TAACCGTTTT TAAATAATCG ACCGAAGATT TCCGCTATTA TTTCATTTCT  GTTTTTACAT TTGGCCAGTG TGTTGCATTT TGTACTTATG TGATTCTTCT TCTTATTCTA TTGTGTGTAT TTTTTATATG TACATTTGTT CGTTGCTTTT TTTATTATGC AATTCCTGAT  GGTGATAGCT TTTAGATTTA ACAATATGGT CTCTGATCAT AAGATTAGAT AATGTGTATA TATATAGGGA TTGATACCAA AATCTTAAGA TTTTGCAACA AAAATTATGA GGCTACAACC  ATTGTTTCAA GGGTATTATC ATTATCTATA TTTCAAAAAC TTCAAAATTA AGTCCATTAT TTTTCTACTG TTTATCTTAC ACTGTTTATG TGGCAAATAC TATAATACCC CTATATTATA  TTACTAATCT TATTCGATAT TACTGTACAT GCGAAGATTA CGACAATGGT AGATTTTGTT CAAATTCAAA TTTGTTGACA ATCAAATTAT CGAATTAACT AATATTTTAT CTAGAGATAG  TGATAATAAT AATCTTATTG GATAAAATTC ATACTTTTCA CGTTGTAACA ACTCGTTAAT TTTTTATATG ATATAATAAA TGAGTTCAGA CGGTAAATAT AAATATATCA CATAACTTAT  AACTTATCAC AATACAAAAT GACTTAGCAT GATATAATTA TAAACTTCTT GATATAAATT TTTTTTATCA TGTTAACCTA ATAAATATTA CCGAGATATT TGTTATCATG TTATCCTGAT  AATACGTTAT CTGCTAACTA TTCTGATGCA TGTATTTTTT TACATGATTA TTCGGTCACA AGTCAACTTT TTTGCTATTC ATGCTAAATA TTTTGTTACT TTTTAATAAT AGTGTTATTG  TGTTCGCATA TATATCAGTC TTTAAAATCT AATCATTGGT 
Retrieve as FASTA  
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGGCAATCGCAGCTTGGTTTTTCATTTTCTGTTACCTTGTTCCCTCTGTTTTTGCGCAGCTCCGGCATGGGTTTTACGAGGGTACATGCCCTCCCGCTGAATCTATCGTGGGTAGA
GTTGTTTTCAACCATTGGGACCGTAACCGAACGGTTACTGCAGCATTGCTTCGTATGCAGTTTCATGATTGTGTTGTCAAA
GTTAGTAACCTAGCTTCTCCTTGTGTGTTTTTATATGTA
TCATGTATGTATGGTATATCGTAAACTAGCTAATATTTTGAATTCTTGTGTAGGGTTGTGATGCTTCCCTCTTGATCGACCCAACAACCGAAAGACCATCAGAGAAAAGCGTCGGGCGAA
ATGCAGGGGTGAGAGGTTTCGAGATCATAGATGAAGCTAAGAAAGAACTCGAGCTTGTTTGCCCGAAAACAGTCTCTTGCGCAGACATTGTAACTATAGCCACCAGAGACTCGATTGCAT
TAGCGGGTGGTCCAAAGTTCAAAGTACGAACAGGAAGACGCGATGGATTAAGATCAAACCCTAGTGATGTTAAATTGCTAGGACCAACAGTTTCCGTGGCTACATCAATCAAAGCATTTA
AATCTATAGGTTTTAATGTAAGCACCATGGTTGCACTTATTGGTGGTGGCCACACTGTCGGTGTTGCACATTGTAGTCTTTTTCAGGATAGGATTAAGGATCCTAAAATGGACAGCAAAC
TGAGAGCTAAGTTAAAGAAGTCATGTCGTGGCCCGAACGACCCATCAGTGTTCATGGACCAAAATACGCCATTTAGAGTAGACAATGAAATCTATAGACAGATGATACAGCAACGAGCAA
TCCTTAGAATTGATGACAACTTGATTCGCGATGGATCAACCAGGTCGATTGTGTCAGATTTTGCATACAACAATAAATTATTCAAAGAGAGTTTTGCCGAAGCGATGCAGAAAATGGGTG
AAATAGGAGTTCTTACGGGAGATTCTGGAGAGATCAGGACAAACTGCAGAGCCTTCAACAACTGA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGGCAATCGCAGCTTGGTTTTTCATTTTCTGTTACCTTGTTCCCTCTGTTTTTGCGCAGCTCCGGCATGGGTTTTACGAGGGTACATGCCCTCCCGCTGAATCTATCGTGGGTAGA
GTTGTTTTCAACCATTGGGACCGTAACCGAACGGTTACTGCAGCATTGCTTCGTATGCAGTTTCATGATTGTGTTGTCAAA
GGTTGTGATGCTTCCCTCTTGATCGACCCAACAACCGAA
AGACCATCAGAGAAAAGCGTCGGGCGAAATGCAGGGGTGAGAGGTTTCGAGATCATAGATGAAGCTAAGAAAGAACTCGAGCTTGTTTGCCCGAAAACAGTCTCTTGCGCAGACATTGTA
ACTATAGCCACCAGAGACTCGATTGCATTAGCGGGTGGTCCAAAGTTCAAAGTACGAACAGGAAGACGCGATGGATTAAGATCAAACCCTAGTGATGTTAAATTGCTAGGACCAACAGTT
TCCGTGGCTACATCAATCAAAGCATTTAAATCTATAGGTTTTAATGTAAGCACCATGGTTGCACTTATTGGTGGTGGCCACACTGTCGGTGTTGCACATTGTAGTCTTTTTCAGGATAGG
ATTAAGGATCCTAAAATGGACAGCAAACTGAGAGCTAAGTTAAAGAAGTCATGTCGTGGCCCGAACGACCCATCAGTGTTCATGGACCAAAATACGCCATTTAGAGTAGACAATGAAATC
TATAGACAGATGATACAGCAACGAGCAATCCTTAGAATTGATGACAACTTGATTCGCGATGGATCAACCAGGTCGATTGTGTCAGATTTTGCATACAACAATAAATTATTCAAAGAGAGT
TTTGCCGAAGCGATGCAGAAAATGGGTGAAATAGGAGTTCTTACGGGAGATTCTGGAGAGATCAGGACAAACTGCAGAGCCTTCAACAACTGA
Retrieve as FASTA  
cDNA +
Send to BLAST
CCATTTCATC ACCAAAACTT AAAACTAAAC ACAATCCAAA AGTATTTTTA AGCTTTCACA TACGAGAGAA AACTTAGAAA ATGAGGGCAA TCGCAGCTTG GTTTTTCATT TTCTGTTACC  TTGTTCCCTC TGTTTTTGCG CAGCTCCGGC ATGGGTTTTA CGAGGGTACA TGCCCTCCCG CTGAATCTAT CGTGGGTAGA GTTGTTTTCA ACCATTGGGA CCGTAACCGA ACGGTTACTG  CAGCATTGCT TCGTATGCAG TTTCATGATT GTGTTGTCAA AGGTTGTGAT GCTTCCCTCT TGATCGACCC AACAACCGAA AGACCATCAG AGAAAAGCGT CGGGCGAAAT GCAGGGGTGA  GAGGTTTCGA GATCATAGAT GAAGCTAAGA AAGAACTCGA GCTTGTTTGC CCGAAAACAG TCTCTTGCGC AGACATTGTA ACTATAGCCA CCAGAGACTC GATTGCATTA GCGGGTGGTC  CAAAGTTCAA AGTACGAACA GGAAGACGCG ATGGATTAAG ATCAAACCCT AGTGATGTTA AATTGCTAGG ACCAACAGTT TCCGTGGCTA CATCAATCAA AGCATTTAAA TCTATAGGTT  TTAATGTAAG CACCATGGTT GCACTTATTG GTGGTGGCCA CACTGTCGGT GTTGCACATT GTAGTCTTTT TCAGGATAGG ATTAAGGATC CTAAAATGGA CAGCAAACTG AGAGCTAAGT  TAAAGAAGTC ATGTCGTGGC CCGAACGACC CATCAGTGTT CATGGACCAA AATACGCCAT TTAGAGTAGA CAATGAAATC TATAGACAGA TGATACAGCA ACGAGCAATC CTTAGAATTG  ATGACAACTT GATTCGCGAT GGATCAACCA GGTCGATTGT GTCAGATTTT GCATACAACA ATAAATTATT CAAAGAGAGT TTTGCCGAAG CGATGCAGAA AATGGGTGAA ATAGGAGTTC  TTACGGGAGA TTCTGGAGAG ATCAGGACAA ACTGCAGAGC CTTCAACAAC TGAAGATCTC TATTCTACAT ACATTTTGTT GGAACTATGA TCAAATCTCG CTTCTGCGTA TTCGTCTTTT  TCTTAACCGT TTTTAAATAA TCGACCGAAG ATTTCCGCTA TTATTTCATT TCTGTTTTTA CATTTGGCCA GTGTGTTGCA TTTTGTACTT ATGTGATTCT TCTTCTTATT CTATTGTGTG  TATTTTTT 
Retrieve as FASTA  
 

<< Back