The peroxidase database
Entry information :
Entry ID 86
Creation 2006-02-02 (Filippo Passardi)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-12 (Christophe Dunand)
Peroxidase information
Name AtPrx10(At1g49570 / PER10 / Atp5a / Atatp5a / AtP5)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis External Link
Organism Arabidopsis thaliana    [TaxId: 3702]
Cellular localisation N/D
Tissue types Mixed tissues
Roots
Rosettes
Inducers Hormon treatment
Stress treatment
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx10
start..stop
S start..stop
AhalPrx15 701 0 1..350 1..350
AlyPrx10 701 0 1..350 1..350
BstrPrx66 675 0 1..350 1..350
CagraPrx12 644 0 1..350 1..356
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18347077..18347355 279 N° 2 18347629..18347820 192 N° 3 18347934..18348099 166 N° 4 18348297..18348712 416
join(18347077..18347355,18347629..18347820,18347934..18348099,18348297..18348712 )


exon

Literature and cross-references
Literature
Protein ref. UniProtKB: Q9FX85
DNA ref. Phytozome 11: Chr1 (18347077..18348712)
mRNA ref. GenBank: NM_103845
Cluster/Prediction ref. Phytozome Gene 11: 19649458 UniGene: At.141
Omic ref. e-FP Browser: At1g49570 TAIR: At1g49570
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid350
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
37948.88 Transmb domain %sTransmembrane domain
Calculation done with TMHMM
The topology is given as the position of the transmembrane helices
separated by i if the loop is on the inside or o if it is on the outside.
For example i7-29o44-66i87-109o means that it starts on the inside,
has a predicted TMH at position 7 to 29, the outside, then a TMH at position 44-66 etc.
i7-29o
PI (ph)%sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
6.62
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDHKMSMYLFVSYLAIFTLFFKGFVSSFPSGYNNGYNNGHGHGLTSNLNYRFYDRSCPRLQTIVKSGVWRAFKDDSRIAASLLRLHFHDCFVNGCDGSILLNDSEDFKGEKNAQPNRNSVRGFEVIEDIKSDIESSCPLTVSCADIVALAAREAVVLTGGPFWPVPLGRRDSLTASEQAANTNLPSPFEALENITAKFVTLGLDLKDVVVLSGAHTIGFAQCFVIKHRLFNFKGSGQPDPNLAASSALLSKLKDTCPNVDSSDSKLAALDAASSVKFDNAYYVNLMNNIGLLDSDQTLMTDPTAAALVKSYSENPYLFSRDFAVSMVKMGNIGVMTGSDGVIRGKCGFPG


Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns), 7 cDNA and 11 ESTs
Promoter +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTATATCGT TTGCTACAAA TTCATAGTAA TGGTTCACAA AAATTTATAG AAATTTCAGT ACTTTTGTTA TAGATATAAA TTTTGAAACG ACAAAATGTT TTGCTACTTT CTACCGCAAT  ACTGTTATCT AATTGTAATT AATTATTTCT AACTTTGACC TAAGTTATAA CTCAACGACG ATACTATAGT ACAAGCTTAT TACTAAACTA CAAATTTAAA CAGGGGTGTG ACTCTAGCTA  GCTAGTTTAT AATAAATGAG ACGCAATGAT GGATATGCAG CTACAAGTGG GTTCATAAAA TATTACATAT CCACTTTGGT TGTGGAAACT GGAAAGTTAT GTAAATTTTG GCCAACCAAA  GGAAGCAAAG ACTTTGCTTC TCAACTCTTC GAGTACACTT CCGAGTAAGC TTCCAACATG GGCACGTAGT GGAATATGTT GCGCAATCCT CTTGATGTCA TAAACATAAT GGACAAAAAT  AATTTAAAAT TTACGTACAC ATGTTTCTTA AAACTCCAAA TTTTATCCGG AAAAATGAAT GTTTTGAAAA GTCTAAGAAC AAGTGCGATA TTATGTGACA AACAGAACAA ATACAAGAAC  AAGAGTTAGA TCGTAAGTAT AAGTTACATT TTCCATCATT TGGTTGTGGT TTGGATGAAA TGTTCTACCG AGCATAATGG CAGCGCTTGT CTAAAGGTTT CCCCCAAAAT CCAAATATCA  TTTTAAATCG AGAGGGATCG GAGTATCATG ATCACAGTTG AATACTCCTT CTTTTATCAA TTAGACCTCG AGTAAATTAT AAATTCCACC ATCCATAAGA AGGTGATACC ATCTTTGGGA  TCGATATTAT CGACCTTTAG AATCCGTTTC AAGTTTGGCA TATATGATAT ATAGTTAAAT TCCAAAGTAT ATTTGCAACG GACCATCTAA TGAAATCCTC GTTTATACTA TGAAGAAGTT  GGAAACATTA CTTAACATAT GTATGTAGAC GAGAGCAATA AATTTCATCA AAGCCTACTT TTCTATTTTG GAGACAAATT TGGCTGATAA TCTATTAATT TGGCCTTTGA AGTGTTTCTA  CTTTCTACGT ATAAGCAAAT TTCTTTTAAC CTCCCTAAAC TTTCTGGAAG ACTTAAAGTA ACTAATATCC CATTCCTCCT TCTTTGGATA TTTACAAAAA TTTCTTTAGT TCGTCTAATT  TAGGATTCTA GACTTGTATT TGAACAAACC CGTAGATAAT TTATTATTTA GGATTTGAAT ATTGATCCGA AGCCACCCCC TATAAATGAT GAGTCTTGCA TGAGAACTAG TTCACATTGA  CTTTGATCAG CTTGGTACGT ACCTAATAAC TTAAAAAGCT TGCTAATTAC CTTATAACTT ACATCCATTG AAGAGATAAA GGGAGATTGA TGGCGGAATT TAGACCGATA TTTTCTCCAA  TAGATCATTA TAAACCGGAT TACATTTTTG CTGTACATAG GCTGCGCTAA ACACCCCAAA TGCGCACAAC GTTATCAATA AAAATGAAAA AGTAAGGGCA TGAGATGATT AGTTTAGATT  ATTTACATGC ACTAATTCTC CCACTATTCA AAACTTATGA GTATACATTT AACATTTACT AGGTTTTGGT TTTTATTTGA ATGTTTGTAT GACGTTTACA AGGAAAAGTT CGTATGACTT  GGTATAATAT ATGGCATTTT AATTCTAGAT AAAATCACAT GCTCACATGG GTAATAACAA ATCATTTATT TTGCCAAGTG ACTGAACTAT CTGACAAAAA CCTAATATTA CAAAAACCTC  AAAATTTATC CCACTATATT ATCTTATTTA TAGTGGCATT CCCACTTTCT TAATTATGCA TGCATCTCCG AGGCGCACCC TTGTTAAGGC AAATATCTAT TTTTTAAAAA TACACCTTGT  TTTTGGTGTA TAAATACAAG CTAAAATCAT CATAGCAATA CACTATCAAT CTACGATCAT ATATCTTTCA TTTCATCATC 
Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTTATATATA GACTCTTCAC AAAATCCAAA TCAGTCTATT ATATATCTAG AGCTAATCTA GCTTTAATGA GGAATCAAAT AAACCAAAGT CTATGAATAA AATATGTTTT ATATATATGG  TGTAAAAGCG TCCTTATGTA TCAATATATA TATATATGGA TCCCATAAAC AAAAATACTT GGACTTGTAT GTGTGTTACG TTTGTGTGTA ATGGAAAATG TATTTGTCTT TGTATTTTTA  TATTCCAAAA TTAAGTCGAA CTCCCTCACT TGAACGAATA TAAATATTCT TAGTTCTTGA TTGGGGTTTA ACTAATGATC ATAATTTTAC ATCTTCTTCC GAAAATCATG GTTCTTTTTG  TTGATATAAC ATACATTTTC TTAAAGTATT GAATATACTA AGTCTACATA AATATACACT ATCTATCAAA AGTCAAAACA AACAAACATC TTAGCGTGAA AAAAGAAAAC ATCTTCGAAA  TAGTTAAAGT CTTAAAAATT GCAACAATTC TTAAATACAC TAACTTTTTG TTTAAAAAAA TAAAAGAAGA TCTTAATTCT TAATGATGAA AATACATAGT TGAAAGAGAA ATGATGAAAA  TACATCCATC AAGCCCAAAT ACAAGCAAAC CCCATTTCAT ATATTTCCAC TTTAAATTCA GACTTGATGC ATATATTTGT TAATTAGAAA AATACGTTTG AACATATATA CATTTATTTA  AATTTTGCGA AAAAGAAGCA AATAAGCATT GAATGATGAT ATACATCCAT CAAATCCAAA TGGAAGCAAC CAACTTTGTA GGTATTGTGT TTGTTGATTA CTGATTGGAA GACATAAATT  TTAAACCATT AAAGTTTCTC CAACGACTTC AAGAAATTAT CAAGATTAGA GTTAGTGGAA GAATGAGAAA TACTTCATAC TATAAGCTAT TTTAATCTAT TATACATATA TAGTCTAAAT  ACAAAATAGT AGTTAGGTTA CGTACACCAT CATGTTAAAT 
Retrieve as FASTA  
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACCACAAAATGTCAATGTATTTGTTTGTGTCTTACCTAGCAATCTTTACTCTTTTCTTCAAAGGCTTTGTCTCCTCGTTTCCTTCGGGATATAACAATGGTTACAACAATGGTCAC
GGACATGGACTAACTAGCAATCTCAACTATCGATTCTATGACCGGTCTTGTCCGCGTCTTCAAACGATTGTTAAGTCCGGAGTTTGGAGAGCTTTTAAAGATGATTCTCGAATCGCTGCA
TCTCTTCTTCGACTCCATTTCCACGATTGTTTTGTCAAT
GTAAGTTTATTTTTGTTTGTTTAATAATATTGTAAGTTACGTGACATTTTCTTTTTATATTTACGCATGCATATATAAGAT
TGTGGATTATATATCACTCACACTAGTCAAACATACTCTATAGGTATTATAAAAATAATCATTCAAATTCTACAGAATTTATAACAATTTTTGTATTATTTAGTATTAAAAAAATACATA
TTAGAGTAGATGTCCTAGACTACAGGGTCTATATATGTGTATCAAATATATAATATTTCCTTTATGTTGTAGGGATGTGATGGATCTATACTTCTGAACGATTCAGAGGATTTCAAAGGA
GAGAAGAACGCTCAGCCAAACCGAAACTCAGTCCGTGGATTCGAAGTCATTGAAGACATTAAATCTGATATCGAAAGTTCTTGTCCCTTAACAGTTTCATGCGCTGACATAGTTGCTCTC
GCGGCTAGAGAAGCTGTCGTCCTC
GTACGTGTGATCTTAAAACCCAAATTCATTAATAATCTGAAATGTCAAAATATTAATGAAAAAACAAAACATAATCGATCGGTTACTTAGTTATGA
CTTCTCATGCCATGCAGACTGGAGGACCGTTTTGGCCCGTGCCTTTGGGACGAAGGGACTCATTAACGGCGAGTGAGCAAGCGGCGAATACAAATCTGCCATCTCCGTTTGAGGCGTTGG
AGAATATAACAGCCAAGTTCGTGACCCTTGGACTCGACCTCAAGGACGTTGTTGTCCTCTCAG
GTTTGGTCACTTCAACTAACGATAAATTATAGAGATAAAAATAATAATATCGATTGA
CTATTGTGTTAATTAACCAAAATAATAAAAACAAACGTAGCAAAATCGATTATTATAAACAAACTTAGATAGAGTAAAGTACTTCATTAGGCATGTATATACATGAATTTATGCTACGAT
ATGACTATACGTGTATGTAGGAGCACATACTATAGGATTTGCTCAATGTTTCGTGATCAAGCATAGACTCTTCAACTTCAAGGGCTCAGGCCAGCCTGACCCAAACCTAGCCGCTTCCTC
AGCACTTCTCTCTAAGCTAAAGGACACGTGTCCTAACGTGGACTCCTCAGACTCTAAGCTCGCTGCTCTTGACGCAGCTAGCTCAGTCAAGTTTGACAATGCTTACTACGTGAACTTAAT
GAACAACATAGGACTGTTGGATTCTGATCAAACCCTAATGACAGATCCTACGGCTGCCGCCTTGGTGAAGTCGTACAGCGAGAATCCGTACTTGTTCTCGAGGGATTTCGCAGTTTCAAT
GGTTAAAATGGGGAATATCGGAGTTATGACCGGAAGTGATGGAGTAATTCGAGGAAAATGTGGATTTCCAGGTTAA
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACCACAAAATGTCAATGTATTTGTTTGTGTCTTACCTAGCAATCTTTACTCTTTTCTTCAAAGGCTTTGTCTCCTCGTTTCCTTCGGGATATAACAATGGTTACAACAATGGTCAC
GGACATGGACTAACTAGCAATCTCAACTATCGATTCTATGACCGGTCTTGTCCGCGTCTTCAAACGATTGTTAAGTCCGGAGTTTGGAGAGCTTTTAAAGATGATTCTCGAATCGCTGCA
TCTCTTCTTCGACTCCATTTCCACGATTGTTTTGTCAAT
GGATGTGATGGATCTATACTTCTGAACGATTCAGAGGATTTCAAAGGAGAGAAGAACGCTCAGCCAAACCGAAACTCAGTC
CGTGGATTCGAAGTCATTGAAGACATTAAATCTGATATCGAAAGTTCTTGTCCCTTAACAGTTTCATGCGCTGACATAGTTGCTCTCGCGGCTAGAGAAGCTGTCGTCCTC
ACTGGAGGA
CCGTTTTGGCCCGTGCCTTTGGGACGAAGGGACTCATTAACGGCGAGTGAGCAAGCGGCGAATACAAATCTGCCATCTCCGTTTGAGGCGTTGGAGAATATAACAGCCAAGTTCGTGACC
CTTGGACTCGACCTCAAGGACGTTGTTGTCCTCTCAG
GAGCACATACTATAGGATTTGCTCAATGTTTCGTGATCAAGCATAGACTCTTCAACTTCAAGGGCTCAGGCCAGCCTGACCCA
AACCTAGCCGCTTCCTCAGCACTTCTCTCTAAGCTAAAGGACACGTGTCCTAACGTGGACTCCTCAGACTCTAAGCTCGCTGCTCTTGACGCAGCTAGCTCAGTCAAGTTTGACAATGCT
TACTACGTGAACTTAATGAACAACATAGGACTGTTGGATTCTGATCAAACCCTAATGACAGATCCTACGGCTGCCGCCTTGGTGAAGTCGTACAGCGAGAATCCGTACTTGTTCTCGAGG
GATTTCGCAGTTTCAATGGTTAAAATGGGGAATATCGGAGTTATGACCGGAAGTGATGGAGTAATTCGAGGAAAATGTGGATTTCCAGGTTAA
Retrieve as FASTA  
cDNA +
Send to BLAST
ACACTATCAA TCTACGATCA TATATCTTTC ATTTCATCAT CATGGACCAC AAAATGTCAA TGTATTTGTT TGTGTCTTAC CTAGCAATCT TTACTCTTTT CTTCAAAGGC TTTGTCTCCT  CGTTTCCTTC GGGATATAAC AATGGTTACA ACAATGGTCA CGGACATGGA CTAACTAGCA ATCTCAACTA TCGATTCTAT GACCGGTCTT GTCCGCGTCT TCAAACGATT GTTAAGTCCG  GAGTTTGGAG AGCTTTTAAA GATGATTCTC GAATCGCTGC ATCTCTTCTT CGACTCCATT TCCACGATTG TTTTGTCAAT GGATGTGATG GATCTATACT TCTGAACGAT TCAGAGGATT  TCAAAGGAGA GAAGAACGCT CAGCCAAACC GAAACTCAGT CCGTGGATTC GAAGTCATTG AAGACATTAA ATCTGATATC GAAAGTTCTT GTCCCTTAAC AGTTTCATGC GCTGACATAG  TTGCTCTCGC GGCTAGAGAA GCTGTCGTCC TCACTGGAGG ACCGTTTTGG CCCGTGCCTT TGGGACGAAG GGACTCATTA ACGGCGAGTG AGCAAGCGGC GAATACAAAT CTGCCATCTC  CGTTTGAGGC GTTGGAGAAT ATAACAGCCA AGTTCGTGAC CCTTGGACTC GACCTCAAGG ACGTTGTTGT CCTCTCAGGA GCACATACTA TAGGATTTGC TCAATGTTTC GTGATCAAGC  ATAGACTCTT CAACTTCAAG GGCTCAGGCC AGCCTGACCC AAACCTAGCC GCTTCCTCAG CACTTCTCTC TAAGCTAAAG GACACGTGTC CTAACGTGGA CTCCTCAGAC TCTAAGCTCG  CTGCTCTTGA CGCAGCTAGC TCAGTCAAGT TTGACAATGC TTACTACGTG AACTTAATGA ACAACATAGG ACTGTTGGAT TCTGATCAAA CCCTAATGAC AGATCCTACG GCTGCCGCCT  TGGTGAAGTC GTACAGCGAG AATCCGTACT TGTTCTCGAG GGATTTCGCA GTTTCAATGG TTAAAATGGG GAATATCGGA GTTATGACCG GAAGTGATGG AGTAATTCGA GGAAAATGTG  GATTTCCAGG TTAAGTTATA TATAGACTCT TCACAAAATC CAAATCAGTC TATTATATAT CTAGAGCTAA TCTAGCTTTA ATGAGGAATC AAATAAACCA AAGTCTATGA ATAAAATATG  TTTTATATAT ATGGTGTAAA AGCGTCCTTA TGTATCAATA TATATATATA TGGATCCCAT AAACAAAAAT ACTTGGACTT GTATGTGTGT TACGTTTGTG TGTAATGGAA AATGTATTTG  TCTTTGTATT TTT 
Retrieve as FASTA  
 

<< Back