The peroxidase database
Entry information :
Entry ID 97
Creation 2006-02-02 (Filippo Passardi)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-05 (Achraf Jemmat)
Peroxidase information
Name (synonym) AtPrx16 (At2g18980 / PER16 / AtperoxP16 / Atp22a / AtP22)
Class Class III peroxidase    [Orthogroup: Prx020]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis External Link
Organism Arabidopsis thaliana    [TaxId: 3702]
Cellular localisation N/D
Tissue types Germinating seeds
Mixed tissues
Roots
Rosettes
Inducers Drought
Hormon treatment
Stress treatment
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx16
start..stop
S start..stop
AlyPrx16 635 0 1..323 1..323
CagraPrx13 611 0 1..323 1..323
CrubPrx115 606 0 1..323 1..323
BrPrx45-1Ab_other 577 0 3..323 6..324
Gene structure Fichier Exons +
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8235085..8235294 210 N° 2 8234461..8234649 189 N° 3 8233914..8234079 166 N° 4 8233419..8233825 407
complement(join(8233419..8233825,8233914..8234079,8234461..8234649,8235085..8235 294))


exon

Literature and cross-references
Literature Ada Linkies, Uta Schuster-Sherpa, Stefanie Tintelnot, Gerhard Leubner-Metzger, and Kerstin Müller. Peroxidases identified in a subtractive cDNA library approach show tissue-specific transcript abundance and enzyme activity during seed germination of Lepidium sativum. J Exp Bot. 2010 January; 61(2): 491–502.
Protein ref. UniProtKB: Q96518
DNA ref. Phytozome 11: Chr2 (8235294..8233419)
mRNA ref. GenBank: NM_127455
Cluster/Prediction ref. Phytozome Gene 11: 19641980 UniGene: At.86
Omic ref. AtProteome: At2g18980 ATTED-II: At2g18980 e-FP Browser: At2g18980 Genevestigator: At2g18980 TAIR: At2g18980
Protein sequence
Sequence Properties
first value : protein
second value (mature protein)
Length (aa) %sProtein length in amino acid 323 (300)
PWM (Da) %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
35695.28 (33177.9) Transmb domain %sTransmembrane domain
Calculation done with TMHMM
The topology is given as the position of the transmembrane helices
separated by i if the loop is on the inside or o if it is on the outside.
For example i7-29o44-66i87-109o means that it starts on the inside,
has a predicted TMH at position 7 to 29, the outside, then a TMH at position 44-66 etc.
i7-26o
PI (pH) %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
10.1 (9.99) Peptide Signal %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 24 range:24-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKNQSSFSIVALLLIFFSSSVFAQLQTNFYRKSCPNVETIVRNAVRQKFQQTFVTAPATLRLFFHDCFVRGCDASILLASPSEKDHPDDKSLAGDGFDTVAKAKQALDRDPNCRNKVSCADILALATRDVVVLTGGPNYPVELGRRDGRLSTVASVQHSLPQPSFKLDQLNTMFARHGLSQTDMIALSGAHTIGFAHCGKFSKRIYNFSPKRPIDPTLNIRYALQLRQMCPIRVDLRIAINMDPTSPNTFDNAYFKNLQKGMGLFTSDQVLFSDERSRSTVNSFASSEATFRQAFISAITKLGRVGVKTGNAGEIRRDCSRVN


Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns), 3 cDNA and 13 ESTs.
Promoter +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAATCAAT AATATGTAGT TATATTTTAT GGTTAGATTC ATTTGTAACT CGAAATATCA ATTTATATAT TTCATGTATA AAGCTGATTA TTTATAAAAT TTTAATATTT TCACTTCATA  AATATATATA ACAATAATAT ATGATATTCT GAAAAAATTA TGAGCAACTA TGTTACTTGT GTGATTTAAA ATTTGCCTAA CTCAATTTTA AACTAAATCT TATTTTATGT ACTTCAACAA  CATTGTGATA GGCTCATGAT TAAAATTTGG ATTGACATCA ACTGAACAAG ATTTGAAAAG TATTCGTATG AAAAAATAAA AAGATAACAA AAATTAAATG TCATTTAAGT CAATATTTTT  TGATCTTCTG TCATTGCATA TATCAATATT AGAGAAATGA TCATGTCTTG AATGATTTGA AATTTGTCTA ACTTGATTAT AAATAAACTA TTTCTAGTTT GATGTGTTCA CTTGATATAA  TACTCCAACA ACAGTGTTAT CGACTCATGA TTAAATATAT AGAATTGATA TAAACTGAAC AAGATTTCAA AAGTATTCAT ATGAAAAGAA TTTAAAAAAA AACAAAAATT AAAGCAGCAT  TTAAGTCAAT ACTTTTAGAT CTTCTCTCAT TGCATATATC CATATAACAG AAATGATCGT GTATTAAATT ATTTGATAGG TCTAATGTTT TAAAGGTTTA TTATTTAAAA AAACTTGAAT  GTCAATGTTA TCAAAGACTC AAAATAAAAT TACTAAACTA ATAAGAGGTT TGGTAACGAA CAAGTACAAC ACAAAAAAAT AGTATAATAA AAAGAGTATA GTAAAAGTAG TGCTTAATTT  ATTATCATTA ATTTTTTTTA TTTTTTTTTA TTTTAAAGAA ATCAATTAAG AGTAGGATTG ATGATATATT TAATTTGCTT ATTTAATTTG ATTAATATTT TAATTTAAAA AATATAGAAT  GACACATGTC ATTTTTTTTT GTGATGATGT GTCATTCATT TGGAGAGAGT TGGCCAACTT TCATATATAT GATTTATATT AGTCAATTGG AGAAATTTAC ACATAAAGAC TAATCAACTT  GATTACTGCC TATATCTCAT CCCTCGTGAT GATCTCCAAT TTCATAAGGT TTTTTCAAGT GATCATTCAC TTAATTGCAC AGAAATATAG TAATGTTTGA TCTTTTTATA CTTTAGTATG  GTCCACGTTC ATTATTTTGC AAACTTGCAT GACTTGTCAA CTTATATTGT ATATCATCAA AAATAATGTA TTCCACATAC ACAAAAACTT ACTTTCCATC ACTAGAGTCA ACTTTAAATC  CTATCCTCGT TGTAAACTTA GATCTTGAGA AGGATGTAAT CTGGTAAGAT GGATCAAATC ACATGAGTTC TTCTTCTTAG TCCCTCTTGT TCAAGTAGTT GCTAAGAAGT GGTAACATGG  CTTTGAGTTG GCAAAGATAA GATTAAGATC AATTTAAACT TGACACCGAG ACTGGTTTAG ATTTTGCCTT TGATTAAGAA AATCTGATTA ATGACACAAA ATATACATTT GTTTTTATAA  CTGTAACTAA TTTCTTCATA ATTATAATTT CAGTCAATAC TAGTATACTA CTCTTTAATG CATCATAAAA AAAAACAGCC ATATATTGAG GGTTGAATTA TATTGTACCC AAAATACATG  GTTGAATAAC ACTCTCAAAG AAACATACAT AATCAAAAGT CCTCAATTAA GCAATTATAG CCTATATATA ACAACAGTAT AATAAAATAA AATATTATAC AAATCACTAT GTGAGCCTCA  ACCTAGCCTC ACATCAAACT CGCAAAATAT ATGATTGGAC ATTACAGAGT GTAACAAAGT CATTATCATA ATTGTATTCT TCAAATTATA AAATAAACTA AATTGCATGT ACCATACGTA  ACCCGTAATT GTAAATTTGA TCAACTCTAT AAATGGAGAC AAAAACACAC ACAATGATCA AAACCTTAAC ATTCTAAGCC 
Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGATTTGTTG TTTCTTTTAT TTAAGAAATT TTGCTTCTTC TTTTTTAAGA TTTGTTTTCT GAATTGTATG GTTCTTTGAC GAAAAAAAAA GAAAAAAAGA AGAATTGTTT CACCACTCTT  ATTCTTATTT CGAACACAAA TTCTCAATAT TGCTAAGGGT TACCACAATT TACAACATAT ACAACGTAAG GTGGAAAGTA CTTACATTGA GAGAAAAATG GCCAAGACTC TTGGCTTAAA  TGAGCTCTCA AAGTTTTATT ATACCTTCTC ATAGGTTAGT GATTCTTTTT TAGAGTTTGA GTATATTTTC CAAAATGGGC TATCCATTTT GCAAGTCATT TTGATCCATT TTGTCTATAT  GAACTTATAA GCCCACTGAT GGGTTACAAA TTTATTGAAA TCAATTCTCG ATTATATAAC TTTCTTGGAA ACTCAATTAT TTTTTCTACG GACGTTTTAG ACTTTCTTTC CTTTTTTGAT  AAAAGATTTT GAATTGTCAA AATCAAAAGA AGAAAAATAA AGAGAAAAAA AATATGTGAA GGAGGATGAG ACTCGTCGTT GCAATTCTAA CCAAAACCTA GAAAATCTGG TCAAACTCTT  CAGTCTCCCT AAAGTATTAC AAACATTAAT GACTTTTTGG CATGGAAGAC AACATCATTC ATTCTTTGAA AGACACCAAC TTTTAACATA TCCAAATCTA AACTAAAATA GTTAGATATT  TGCACTAAAA CCAAAATTGA TCTACTTTCA ATTTAGAATA ACATTCTAAA ACTTCATTGA CGACCTCTTT AACATTGTTG ATATCTTGTA GTTAGATCGT TTAACTATTA CAAGATACTA  CTAATCATTA ATCAAATTGT TTTTAATAAA TTCTTAACTA ATGTGTTTTG ATAATTAACG AATTGTATGG TATATGAAGG AAATAAATGA GGGGTTTAGG AATGTAAAGT TGTAAAGTAA  ATGCACGTGG AGACATTTGT GGAATGCATC CAAATGAAGT ATAAAACAAT GTACTTAACA CAATCCACAT GCTCCTCTTC AATCCAAAAC CATATCTGTG GGTCCCTATT TTTCCAAATT  ACAT 
Retrieve as FASTA  
DNA +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAACCAAAGCAGCTTCTCCATTGTTGCTCTTCTTCTCATTTTCTTTTCCTCATCTGTCTTTGCTCAGCTGCAGACAAATTTTTACCGGAAGTCATGTCCTAACGTGGAAACTATT
GTCCGCAATGCCGTCCGCCAAAAGTTCCAGCAGACTTTTGTTACGGCTCCGGCCACCCTCCGCCTTTTCTTCCATGATTGCTTCGTCCGT
GTAAGTTTTTTTTAAATCGATATATTAGTT
TACATTTTGTAAACGATAATGGGTAGAAAAAGCATATTGTACGTGTTTTTAATGTAAATATAAATATTAAATAAGTAAATAAAAAACATAAATATGAATATATTTGTTTTAAATAAAGTG
TTATTGGTAATTTCATTTGCAAAAAAAAATAATTAAATAGATTTTATTACTTTTTGTCTATGGATTCTATAATGATTTTGTAGTTCTATGAATTTTGAATGTTGTTAAAATAAAGATTTT
AAATTTATAAACTAAAAACTAAACATTCAAAATACTACGAAGTTATCATAATGTTTTAAAAACTTATGAAAAAATAAAGAAATCTCTCCTATATATTAGTATAATGTTTGGCCCGTGTTC
AAAAAAAAAAGTATATATTGTTTGACTATTTAACGTTATATACAGGGATGTGATGCTTCGATATTGCTGGCATCACCATCTGAGAAGGATCACCCTGATGACAAGTCACTAGCCGGAGAC
GGGTTTGATACGGTGGCAAAGGCAAAGCAGGCCCTTGATAGGGACCCCAACTGCCGTAACAAAGTCTCATGCGCTGACATTTTGGCTCTCGCCACTCGTGACGTCGTCGTTTTG
GTACAT
TTCAATTCTTATATTGATCTTTATCTAATTTCCTTGACACCTTATTCATCTCTTCAAAATTCTATTATTAATGTAGGCTAAAATGAAATGTCCCGAAAGAAAAATCTAGGCTTGAAGGAA
TATCTACACTAATTAAGTAACTTGAATTCATTACTGTTTCGTTTACTATGAAGAAACAAAATCATGGAACACGTACGTGTTGATCAACCCGTGAAAAAATGTTCATTACCTAATTAAGTA
AATATAGTAGGATTATTTAGCTAACGTGTCCTAACGATTTGGTTATTATTCCCTTTTTGTGTGATTATATTCTTTTTCATTTTGTGTCATTATTACTAAAAGACTTGTGAAATTAAAGAT
AATAATATATTGTAGACCGGAGGACCGAACTATCCGGTAGAGCTAGGGAGGAGAGACGGCAGACTATCGACAGTGGCTAGCGTTCAACACAGTCTACCCCAGCCTAGTTTCAAATTGGAC
CAACTTAACACTATGTTCGCTCGTCACGGTCTATCCCAAACCGATATGATTGCACTCTCAG
GTATTTAAACCGAAGCAAAACCGGAGTAGACGGATTTTAATTTCATATATTATAACCAA
GTCTAACAGATAATTTTTATGATATGCAGGAGCACATACTATAGGATTCGCACATTGTGGCAAGTTTTCGAAAAGAATTTACAATTTTAGTCCTAAACGTCCAATTGATCCGACTTTGAA
TATTCGTTACGCCTTACAATTGAGACAAATGTGCCCCATTCGGGTCGACTTGAGGATCGCAATTAACATGGATCCTACTTCTCCAAATACATTTGACAATGCTTATTTCAAAAACCTCCA
AAAAGGGATGGGTTTGTTCACGTCAGATCAAGTTTTGTTCTCTGATGAACGATCTAGATCAACTGTCAATTCATTTGCTTCTAGTGAAGCAACTTTTAGACAAGCTTTTATTTCGGCTAT
AACGAAGTTGGGTCGGGTTGGAGTTAAAACCGGTAACGCGGGTGAGATAAGACGGGATTGTTCACGTGTTAATTAG
Retrieve as FASTA  
CDS +
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAACCAAAGCAGCTTCTCCATTGTTGCTCTTCTTCTCATTTTCTTTTCCTCATCTGTCTTTGCTCAGCTGCAGACAAATTTTTACCGGAAGTCATGTCCTAACGTGGAAACTATT
GTCCGCAATGCCGTCCGCCAAAAGTTCCAGCAGACTTTTGTTACGGCTCCGGCCACCCTCCGCCTTTTCTTCCATGATTGCTTCGTCCGT
GGATGTGATGCTTCGATATTGCTGGCATCA
CCATCTGAGAAGGATCACCCTGATGACAAGTCACTAGCCGGAGACGGGTTTGATACGGTGGCAAAGGCAAAGCAGGCCCTTGATAGGGACCCCAACTGCCGTAACAAAGTCTCATGCGCT
GACATTTTGGCTCTCGCCACTCGTGACGTCGTCGTTTTG
ACCGGAGGACCGAACTATCCGGTAGAGCTAGGGAGGAGAGACGGCAGACTATCGACAGTGGCTAGCGTTCAACACAGTCTA
CCCCAGCCTAGTTTCAAATTGGACCAACTTAACACTATGTTCGCTCGTCACGGTCTATCCCAAACCGATATGATTGCACTCTCAG
GAGCACATACTATAGGATTCGCACATTGTGGCAAG
TTTTCGAAAAGAATTTACAATTTTAGTCCTAAACGTCCAATTGATCCGACTTTGAATATTCGTTACGCCTTACAATTGAGACAAATGTGCCCCATTCGGGTCGACTTGAGGATCGCAATT
AACATGGATCCTACTTCTCCAAATACATTTGACAATGCTTATTTCAAAAACCTCCAAAAAGGGATGGGTTTGTTCACGTCAGATCAAGTTTTGTTCTCTGATGAACGATCTAGATCAACT
GTCAATTCATTTGCTTCTAGTGAAGCAACTTTTAGACAAGCTTTTATTTCGGCTATAACGAAGTTGGGTCGGGTTGGAGTTAAAACCGGTAACGCGGGTGAGATAAGACGGGATTGTTCA
CGTGTTAATTAG
Retrieve as FASTA  
cDNA +
Send to BLAST
CAAAACCTTA ACATTCTAAG CCATGAAGAA CCAAAGCAGC TTCTCCATTG TTGCTCTTCT TCTCATTTTC TTTTCCTCAT CTGTCTTTGC TCAGCTGCAG ACAAATTTTT ACCGGAAGTC  ATGTCCTAAC GTGGAAACTA TTGTCCGCAA TGCCGTCCGC CAAAAGTTCC AGCAGACTTT TGTTACGGCT CCGGCCACCC TCCGCCTTTT CTTCCATGAT TGCTTCGTCC GTGGATGTGA  TGCTTCGATA TTGCTGGCAT CACCATCTGA GAAGGATCAC CCTGATGACA AGTCACTAGC CGGAGACGGG TTTGATACGG TGGCAAAGGC AAAGCAGGCC CTTGATAGGG ACCCCAACTG  CCGTAACAAA GTCTCATGCG CTGACATTTT GGCTCTCGCC ACTCGTGACG TCGTCGTTTT GACCGGAGGA CCGAACTATC CGGTAGAGCT AGGGAGGAGA GACGGCAGAC TATCGACAGT  GGCTAGCGTT CAACACAGTC TACCCCAGCC TAGTTTCAAA TTGGACCAAC TTAACACTAT GTTCGCTCGT CACGGTCTAT CCCAAACCGA TATGATTGCA CTCTCAGGAG CACATACTAT  AGGATTCGCA CATTGTGGCA AGTTTTCGAA AAGAATTTAC AATTTTAGTC CTAAACGTCC AATTGATCCG ACTTTGAATA TTCGTTACGC CTTACAATTG AGACAAATGT GCCCCATTCG  GGTCGACTTG AGGATCGCAA TTAACATGGA TCCTACTTCT CCAAATACAT TTGACAATGC TTATTTCAAA AACCTCCAAA AAGGGATGGG TTTGTTCACG TCAGATCAAG TTTTGTTCTC  TGATGAACGA TCTAGATCAA CTGTCAATTC ATTTGCTTCT AGTGAAGCAA CTTTTAGACA AGCTTTTATT TCGGCTATAA CGAAGTTGGG TCGGGTTGGA GTTAAAACCG GTAACGCGGG  TGAGATAAGA CGGGATTGTT CACGTGTTAA TTAGTGATTT GTTGTTTCTT TTATTTAAGA AATTTTGCTT CTTCTTTTTT AAGATTTGTT TTCTGAATTG TATGGTTCTT TGACGAAA 
Retrieve as FASTA  
 

<< Back