Entry information : AtPrx19 (At2g34060 / PER19 / AtP51)
Entry ID 100
Creation 2006-02-02 (Filippo Passardi)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-04 (Achraf Jemmat)
Peroxidase information: AtPrx19 (At2g34060 / PER19 / AtP51)
Name (synonym) AtPrx19 (At2g34060 / PER19 / AtP51)
Class Class III peroxidase    [Orthogroup: Prx034]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type Rosettes
Inducer Cold stress
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx19
start..stop
S start..stop
CrubPrx59 630 0 1..346 1..347
CagraPrx63 626 0 1..346 1..347
BstrPrx82 624 0 1..346 1..348
BrPrx19-2Aa_other 609 0 1..346 1..348
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14384914..14385174 261 N° 2 14385568..14385768 201 N° 3 14385952..14386530 579  
join(14384914..14385174,14385568..14385768,14385952..14386530)


exon

Literature and cross-references AtPrx19 (At2g34060 / PER19 / AtP51)
Protein ref. UniProtKB:   O22959
DNA ref. Phytozome 11:   Chr2 (14384914..14386530)
mRNA ref. GenBank:   NM_128957
Cluster/Prediction ref. Phytozome Gene 11:   19639325 UniGene:   At.37862
Omic ref. ePlant:   At2g34060 TAIR:   At2g34060
Protein sequence: AtPrx19 (At2g34060 / PER19 / AtP51)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346 (315)
PWM (Da):   %s   38090.84 (34683.0) Transmb domain:   %s   i5-27o
PI (pH):   %s   9.61 (9.61) Peptide Signal:   %s   cut: 32 range:32-346
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHVISLSLSSIFFFLFLTSTILISPVQPTTSKPPAPRPHRELSADYYSKKCPQLETLVGSVTSQRFKEVPISAPATIRLFFHDCFVEGCDGSILIETKKGSKKLAEREAYENKELREEGFDSIIKAKALVESHCPSLVSCSDILAIAARDFIHLAGGPYYQVKKGRWDGKRSTAKNVPPNIPRSNSTVDQLIKLFASKGLTVEELVVLSGSHTIGFAHCKNFLGRLYDYKGTKRPDPSLDQRLLKELRMSCPFSGGSSGVVLPLDATTPFVFDNGYFTGLGTNMGLLGSDQALFLDPRTKPIALEMARDKQKFLKAFGDAMDKMGSIGVKRGKRHGEIRTDCRVFL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, intron 1 and 2), 3 cDNA and 2 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTCAAGCAGC TTGTAGCGAG AGTCGTTCAA ATAAAACGAT TGAGCTGTCT CCATGATCCA TTTAGCCTCC TCGTCAGTGA GTTTGCTTGT GAACACAACA TCGCCTCGGA TAAAGACCAA  GTCTTTTGTC TCTGAAAGCT CAGTGTAGAA GGTTGTAGTC AGGTAAGGAG CCGCTTGAGT TCCTCTTGCT TTGTAGTCTT CGAGACCAGT AAAAATCATG TGAGGCGCTT CAACTGCCAC  AATAAAACTG ACCATTTATA TAAGATCATA ATGAACTCTT CAGCCGAGTT ACATAACTGT TGTAATGAAG CTCAACATGA ATTAAATGGT ACATCTAGCC TCACATATCA ACACACCAGG  TAAATGAACT GTTCTTGAGA TTAGTAGTTT GTTAATTTCT TTCCTGACTA AGTTAAACAT TTCCACTGCT AATCTCACTA AGTTAACTGA ACTTTCAGAT AAACTATTCT TGCGATCAGT  AGTTCGCTAA TTTTTGTTCT GACAAAATAA GTGCAAGTAA AAGAAGATCC ATTGCTAATG AATCTCACTA ATTTAACTGA ACTTAAAAGC TACCACAAAT CTGGAGCAAG CATTGTTATG  TAACCATTTC ATATAAATTT CTCACAAGGA AATGAAAGAT GTATATATAA TGGAGGATTA AAGTTAGAAC CTTGAGCAAA CATTGTTATG TAACCATTTC CTCTCCACAA TGGAATGACA  AAGTATCGGC TGCAATTTGC AACATCAATT AGAAAAAGAA AAAAAAGATC AAAGGATTAT AATCAAACAA GAACAAGGCT TAATGATGTT ATTACCACTC GGAGGCTCGT TGCTCCAACA  ATCGATAAAG CTGAGCTTTC ATCGTTAACC CAATATGACC TCGTCCCAAA TGATACTGAC AAATTGAAAA TGTAGTAAGA TCCAACGAAA TGCAATTGAA AGACAGAAAA TTTCACATAA  AAAGAGAAAT TTTGAGATTA CATCGTCCCA GATCGAAGTG AGTTCTTCAG GGGATTTAGT CTTGGCTCTG GCCAAATCCA TGATTGAATC CAAAGGTTTT TGCTGCAATG GTGTAAAACC  AGATGCGAAT CTCGAATTTC TGACTGAACC AAGCGAAGCC CATTTTATGT GGTTTCCAGG TAAAGAAGCT TCTGAGAGCT TACTTGATGC ATCTCGTTGC CAAGAAGATG AACGCGCAGT  GAAAATTTGT CTAGACGAAG AATAAGAAGA TGAAGAGAGC TTATCTTTAG CAAGACTCGA AATTGAACCG ACGATTCTTC TCATTTTTAT GGTATGAATA CGGTGAAATT CAAAGAAACT  ATGAAGATAT GCACAGTTCT CTGGAAATCT CAGATTTAGA ACCCTAACCG GAAACGAAGC CGGCTCGAGA TTTCGTGGGT AACTTGGTTC GACGGTCCAA ACCGGATTTT AGTAATTTCG  CTTTTTCTGA ACCAATAATA ATGGGCTGGT CCAGAGTCTA AAATTTCCGG ATTACTCGAC CTGACTTCTA AACTAAACCA ATGTTCAATG GACTTCACCT AGTACTGTTT AGTATTTACA  TATATATATT TTTGTTCTAC CACAGTTATG TTTAACATGG CAAATTACAT GAACACATTA TTATTGATCC TTTTAGAAAA TGTGTAATAG TCACAGGAAC ACATTATTAC GCATTCTACT  CGAAAGATTC TATAAAGATT TTTTTTTTAT TGTCGGCAGT AGATCTATAA AGTTAATATA AGCCATGATT GCTTCCACAT TTTAGACTAA AATACACAGA AAAAAATGAG ATCTTAACCC  ATGTTTCACA AATTTCCTGT CACTCTTTGT TTTTTGTCTC ACAAAAGTAT TTTGTGTTAT AACAAAATCA ACTTGTTTGT CACTGATATG AGATTTGACT TAGGTTGTTT TGTTGTCATT 
ATTTTGAACC GTACAAAAAA CTGTAAACTA TTTATAAGTT GGTCCAGACT CACAGTATCT CACAAGTCAC AACCCCACC 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATTTTCTTTA TTGTCTTGTC TGATGGTTTT TGTCTTGATC TTGATGTGTT CTGTGTCATG TGTCCTTTAA TTTATTAGCA TTTTCGTGAT TGTTTTGTTG ATAGTATAAG GTATTTTTTT  AAAGCAACAC TAACTTATCG AGAATTAAGA CTATCTTTAT CAATGGACTC TTACATGTAG TTCTAAACAA TTTTGATATA TAACATAATG TTTAAATATT AGAAAGGCTC TTACAAAAGA  AGAGAATAAG ATCATCTTTG TCAATGGACT CTTACATGTA GTTCTAAACA ATTTTGATAT ATAACATAAT GTTTAAATAT TAGAAAGGCT CTTACAAAAG AAGAGAATAA GGAAAAAAAC  TCTTAGCTAA GAGCCATTTT TCATCTCTTA AGCACACTTT TTTATTTTTT TTATTTTTAT TTTGTTTAAT ATAATATTTT GATAGTTCTT ATGATATTGT TAACAACCTA TTGATAATGA  TGCTCTAAGG AAGAAAACTC TTAGCTAAGA GCCATTTTTC ATCTCTTAAG CACACTTTTT TATTTTTTTA TTCTTATTTT GTTTAATATA ATATTTTGAT AATTCTTATG ATATTGTTAA  CAACCTATTG ATAATGATGC TCTAAGGTAT TTGTCAAAAA GATTATTATA TATATGTTAT TGGTGACAAT ATTACAACTT TAAAGTGTTT TACATGAGAA GGCTCACAAC TACTTAAAAG  TCGAATTTTA TCTTAAGCCA GGATTCGAGT TTATATATGG GAATTTCAAA TGCTGCTACC TAGTTGATCT AATCCATTTC AATAGAATAA ACAAATTCTT ATATGTCTAC TTACTTTCAA  ATCAAATTAA GAAGCCATGA TGTGTATAAT GTGGTTACTC TTAGATCATT TTTTTGGTAA TCACAATCGA AGTCGATTAG ATTATGATTT GTAACCACCC AAGAGTAAAG AATATAAAAC 
ACTTTACAAC TTTATCGTCA TATACTCTTT CTAATCTTC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATGTCATATCTCTTTCGTTATCCTCAATATTCTTTTTCCTCTTCCTCACATCAACCATTTTGATTTCTCCGGTACAACCCACAACCTCTAAGCCTCCGGCACCACGGCCCCACAGA
GAGCTCTCCGCCGATTACTACTCCAAGAAATGTCCTCAGCTTGAAACTCTCGTCGGTTCCGTCACTTCTCAGCGGTTCAAAGAAGTCCCCATCTCAGCTCCAGCCACCATTCGCCTCTTC
TTTCACGACTGCTTCGTTGAG
GTCAAAATTTTACCAAAATTGGAAATTTGTATTATCTTTCTCAGGCATGCCAGCGCACTATAGCATAATTAACCATGTACCATAACACACGCATTTTAG
CATTAGTAACTAGCATGGTCAAATATAATGTACAATCTCATTATGTCGCAATAATTATTGCAAAAGTCATAACACCAATATGGAAATAGTTCACCGGTTTGGTTTCCAACGTAGCGCATT
TTAGCAAACAAAAGTCAAGATTCAGCGCATTTTAGTGAAAAACTCAACAGTATTTTGGTCTGCATTATTGCTTGTTTAACAAATAACAGTGCACATCTCATGCGTAAAAACTAATAAATT
ATGGACTACGGTGATTGATAACCAATAATATTAGTTGAAATTGGAATTTTGAAGGGTTGTGATGGGTCGATATTGATAGAAACAAAGAAAGGAAGCAAGAAATTAGCAGAGAGAGAAGCA
TATGAGAATAAGGAATTGAGAGAGGAAGGATTTGATAGTATCATCAAGGCGAAGGCCTTGGTTGAGTCTCATTGCCCTTCTCTCGTCTCTTGCTCTGATATTCTCGCTATTGCCGCTCGA
GATTTCATTCATCTG
GTAATTCGAACTTCAATTCTACATTCCTACTTCCGAATAAGTTTCCATTCATATGATTTGATTATTGATGTGTCCACTGTCCAAACCGGTCTTGGACCAAACCGT
ATTGTCCACTCCAATGGTTGATGACTTGATGGTATATCTACGTGTCATTGAATAATGTTTTGTTATGATTCCAAATAGGCAGGTGGGCCTTACTATCAAGTGAAAAAAGGAAGGTGGGAC
GGAAAAAGATCAACGGCAAAGAACGTCCCTCCAAACATACCTCGATCAAACTCCACCGTTGATCAACTCATCAAGCTCTTCGCGTCCAAAGGACTAACCGTAGAGGAACTCGTCGTCCTT
TCTGGTTCCCACACCATCGGCTTCGCCCATTGTAAAAATTTCCTTGGTCGTCTCTACGACTACAAAGGCACAAAACGACCCGACCCGAGTCTTGACCAAAGATTACTAAAAGAGCTCCGG
ATGTCTTGTCCTTTTTCCGGCGGAAGCTCTGGAGTCGTCCTTCCGCTCGACGCTACAACTCCGTTTGTGTTTGATAATGGATATTTCACAGGTCTAGGAACCAACATGGGCCTTCTCGGG
TCGGACCAAGCTTTGTTCCTTGACCCGAGGACGAAGCCCATTGCACTTGAGATGGCAAGAGATAAGCAGAAGTTTCTCAAGGCGTTTGGAGACGCTATGGATAAAATGGGTTCCATTGGT
GTAAAGAGAGGGAAGAGACATGGGGAAATACGTACGGATTGTCGAGTCTTTTTATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATGTCATATCTCTTTCGTTATCCTCAATATTCTTTTTCCTCTTCCTCACATCAACCATTTTGATTTCTCCGGTACAACCCACAACCTCTAAGCCTCCGGCACCACGGCCCCACAGA
GAGCTCTCCGCCGATTACTACTCCAAGAAATGTCCTCAGCTTGAAACTCTCGTCGGTTCCGTCACTTCTCAGCGGTTCAAAGAAGTCCCCATCTCAGCTCCAGCCACCATTCGCCTCTTC
TTTCACGACTGCTTCGTTGAG
GGTTGTGATGGGTCGATATTGATAGAAACAAAGAAAGGAAGCAAGAAATTAGCAGAGAGAGAAGCATATGAGAATAAGGAATTGAGAGAGGAAGGATTT
GATAGTATCATCAAGGCGAAGGCCTTGGTTGAGTCTCATTGCCCTTCTCTCGTCTCTTGCTCTGATATTCTCGCTATTGCCGCTCGAGATTTCATTCATCTG
GCAGGTGGGCCTTACTAT
CAAGTGAAAAAAGGAAGGTGGGACGGAAAAAGATCAACGGCAAAGAACGTCCCTCCAAACATACCTCGATCAAACTCCACCGTTGATCAACTCATCAAGCTCTTCGCGTCCAAAGGACTA
ACCGTAGAGGAACTCGTCGTCCTTTCTGGTTCCCACACCATCGGCTTCGCCCATTGTAAAAATTTCCTTGGTCGTCTCTACGACTACAAAGGCACAAAACGACCCGACCCGAGTCTTGAC
CAAAGATTACTAAAAGAGCTCCGGATGTCTTGTCCTTTTTCCGGCGGAAGCTCTGGAGTCGTCCTTCCGCTCGACGCTACAACTCCGTTTGTGTTTGATAATGGATATTTCACAGGTCTA
GGAACCAACATGGGCCTTCTCGGGTCGGACCAAGCTTTGTTCCTTGACCCGAGGACGAAGCCCATTGCACTTGAGATGGCAAGAGATAAGCAGAAGTTTCTCAAGGCGTTTGGAGACGCT
ATGGATAAAATGGGTTCCATTGGTGTAAAGAGAGGGAAGAGACATGGGGAAATACGTACGGATTGTCGAGTCTTTTTATAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACAAGTCACA ACCCCACCAT GCATGTCATA TCTCTTTCGT TATCCTCAAT ATTCTTTTTC CTCTTCCTCA CATCAACCAT TTTGATTTCT CCGGTACAAC CCACAACCTC TAAGCCTCCG  GCACCACGGC CCCACAGAGA GCTCTCCGCC GATTACTACT CCAAGAAATG TCCTCAGCTT GAAACTCTCG TCGGTTCCGT CACTTCTCAG CGGTTCAAAG AAGTCCCCAT CTCAGCTCCA  GCCACCATTC GCCTCTTCTT TCACGACTGC TTCGTTGAGG GTTGTGATGG GTCGATATTG ATAGAAACAA AGAAAGGAAG CAAGAAATTA GCAGAGAGAG AAGCATATGA GAATAAGGAA  TTGAGAGAGG AAGGATTTGA TAGTATCATC AAGGCGAAGG CCTTGGTTGA GTCTCATTGC CCTTCTCTCG TCTCTTGCTC TGATATTCTC GCTATTGCCG CTCGAGATTT CATTCATCTG  GCAGGTGGGC CTTACTATCA AGTGAAAAAA GGAAGGTGGG ACGGAAAAAG ATCAACGGCA AAGAACGTCC CTCCAAACAT ACCTCGATCA AACTCCACCG TTGATCAACT CATCAAGCTC  TTCGCGTCCA AAGGACTAAC CGTAGAGGAA CTCGTCGTCC TTTCTGGTTC CCACACCATC GGCTTCGCCC ATTGTAAAAA TTTCCTTGGT CGTCTCTACG ACTACAAAGG CACAAAACGA  CCCGACCCGA GTCTTGACCA AAGATTACTA AAAGAGCTCC GGATGTCTTG TCCTTTTTCC GGCGGAAGCT CTGGAGTCGT CCTTCCGCTC GACGCTACAA CTCCGTTTGT GTTTGATAAT  GGATATTTCA CAGGTCTAGG AACCAACATG GGCCTTCTCG GGTCGGACCA AGCTTTGTTC CTTGACCCGA GGACGAAGCC CATTGCACTT GAGATGGCAA GAGATAAGCA GAAGTTTCTC  AAGGCGTTTG GAGACGCTAT GGATAAAATG GGTTCCATTG GTGTAAAGAG AGGGAAGAGA CATGGGGAAA TACGTACGGA TTGTCGAGTC TTTTTATAGA TTTTCTTTAT TGTCTTGTCT 
GATGGTTTTT GTCTTGATCT TGATGTGTTC TGTGTCATGT GTCCTTTAAT TTATTAGCAT TTTCGTGATT GTTTTGTTGA TAGTATAAGG TATTTTTTTA AAGCAACACT AACTTATC 

Retrieve as FASTA