Entry information : StheGPx01
Entry ID 10009
Creation 2011-12-20 (Passaia Gisèle)
Last sequence changes 2011-12-20 (Passaia Gisèle)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-08 (Christophe Dunand)
Peroxidase information: StheGPx01
Name StheGPx01
Class Fungi-Bacteria glutathione peroxidase    [Orthogroup: Gpx3001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Chaetomiaceae Thielavia
Organism Sporotrichum thermophile (Myceliophthora thermophila)    [TaxId: 573728 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value StheGPx01
start..stop
S start..stop
CgGPx01 343 2e-121 1..237 1..236
TterGPx01 324 6e-114 23..237 19..232
HEC38GPx01 308 2e-107 5..237 11..246
HCO27GPx01 305 3e-106 5..237 11..246
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2160600..2160852 253 N° 2 2160035..2160495 461  
complement(join(2160035..2160495,2160600..2160852))


exon

Literature and cross-references StheGPx01
DNA ref. JGI genome:   chromosome_2 (2160852..2160035)
Protein sequence: StheGPx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   238
PWM (Da):   %s   26160.78  
PI (pH):   %s   10.15
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFPSPSTSIIRRQLAVSGPYVRTSKAGLSTATALSILRRSQPSPLPRATPKPATAAFPKQQVPLRRSIANMASATTFYDFKVADKKGAEVSLADYKGKVVLIVNTASKCGFTPQYAGLEKLWKTVREKYPDDFVILGFPCNQFGGQEPGTNEEIQEFCQLNYGVTFPIMAKIDVNGDNASPLFEWLKNEKPGLLGLKRVKWNFEKFLVGKDGRVKGRWASTTKPESLEATILEELAK

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 1 intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCCTTCTCCATCTACATCCATCATCCGCCGCCAGCTCGCAGTTTCCGGTCCGTACGTTCGCACATCGAAAGCCGGATTGTCAACAGCGACTGCGTTGTCGATCCTTCGCCGCTCT
CAACCGTCGCCTCTGCCTCGCGCCACACCCAAACCCGCAACTGCAGCATTCCCGAAGCAACAGGTTCCGCTCCGCAGATCAATTGCAAACATGGCCTCCGCAACAACCTTTTATGACTTC
AAGGTCGCAGACA
GTACGTGATATGAAGTTGCCTCTTCCGAGCATATATATATTATCCTAACCCAGCCTTGATGTCGCTTGATGTTGCTTGACGTCACGTACTAACGAAATCATCAGAGA
AGGGCGCCGAGGTGTCCCTTGCCGACTACAAGGGCAAGGTCGTCCTCATCGTCAACACAGCCTCCAAGTGCGGTTTTACCCCGCAGTACGCCGGCTTGGAGAAGCTGTGGAAGACGGTGC
GCGAGAAGTACCCGGACGACTTCGTCATCCTGGGCTTCCCGTGCAACCAATTCGGCGGGCAGGAACCCGGCACCAACGAGGAGATCCAGGAGTTCTGCCAGCTCAATTACGGCGTCACCT
TCCCCATCATGGCCAAGATTGACGTCAACGGTGACAACGCCAGCCCCCTGTTCGAGTGGCTCAAGAATGAGAAGCCCGGCTTGCTGGGGCTGAAGAGGGTCAAGTGGAACTTTGAGAAGT
TCCTTGTTGGCAAAGATGGCAGAGTGAAGGGCCGGTGGGCGTCGACCACGAAGCCGGAGTCGTTGGAGGCGACCATTCTGGAGGAGTTGGCGAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCCTTCTCCATCTACATCCATCATCCGCCGCCAGCTCGCAGTTTCCGGTCCGTACGTTCGCACATCGAAAGCCGGATTGTCAACAGCGACTGCGTTGTCGATCCTTCGCCGCTCT
CAACCGTCGCCTCTGCCTCGCGCCACACCCAAACCCGCAACTGCAGCATTCCCGAAGCAACAGGTTCCGCTCCGCAGATCAATTGCAAACATGGCCTCCGCAACAACCTTTTATGACTTC
AAGGTCGCAGACA
AGAAGGGCGCCGAGGTGTCCCTTGCCGACTACAAGGGCAAGGTCGTCCTCATCGTCAACACAGCCTCCAAGTGCGGTTTTACCCCGCAGTACGCCGGCTTGGAGAAG
CTGTGGAAGACGGTGCGCGAGAAGTACCCGGACGACTTCGTCATCCTGGGCTTCCCGTGCAACCAATTCGGCGGGCAGGAACCCGGCACCAACGAGGAGATCCAGGAGTTCTGCCAGCTC
AATTACGGCGTCACCTTCCCCATCATGGCCAAGATTGACGTCAACGGTGACAACGCCAGCCCCCTGTTCGAGTGGCTCAAGAATGAGAAGCCCGGCTTGCTGGGGCTGAAGAGGGTCAAG
TGGAACTTTGAGAAGTTCCTTGTTGGCAAAGATGGCAGAGTGAAGGGCCGGTGGGCGTCGACCACGAAGCCGGAGTCGTTGGAGGCGACCATTCTGGAGGAGTTGGCGAAGTAA

Retrieve as FASTA