Entry information : BcomCP
Entry ID 10025
Creation 2011-12-21 (Christophe Dunand)
Last sequence changes 2011-12-21 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: BcomCP
Name BcomCP
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Baudoinia
Organism Baudoinia compniacensis    [TaxId: 430998 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BcomCP
start..stop
S start..stop
OmaiCP01 1132 0 4..754 3..752
LpaluCP01 1119 0 4..754 3..753
MmycCP1 1112 0 4..748 3..750
ZcelCP01 1108 0 1..754 1..758
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 945620..945897 278 N° 2 945955..947941 1987  
join(945620..945897,945955..947941)


exon

Literature and cross-references BcomCP
DNA ref. JGI genome:   scaffold_13 (945620..947941)
Cluster/Prediction ref. JGI gene:   38528
Protein sequence: BcomCP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   754
PWM (Da):   %s   84078.86  
PI (pH):   %s   6.25
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKECPIKLANTGGGGTRNFDWWPDQLRLNILRQQTPVTNPMGQDFDYAEAWKSVDYKALKEDIRHVLTTSQEWWPADFGHYGGLFIRMAWHSAGTYRVLDGRGGGGGGQQRFAPLNSWPDNVSLDKARRLLWPVKQKYGNKVSWADLMLLTGNVSLEDMGLQTFGFAGGRADQWEADESVYWGGETTWLGNDVRYSQGHEGLAEGGVVDGDMHKVDAKDIHSRDLEKPVAASHMGLIYVNPEGPDGIPDPVAAARDIRTTFGRMAMNDYETAALIIGGHTFGKTHGAGSADHVGKEPMAAPIESQGLGWNSKYNSGSGRDTITSGLEVTWTKTPTKWSNHYLEYLFKFDWELTKSPAGANQWEAKNADNMIPAADGDPNKMQKPRMLTTDLSMRYDKEYEKISRHFLEHPDELADAFARTWFKLLHRDMGPRTRWIGPEIPKEILLWEDPVPSVDHELISSEDANQLKKEILGTGIEPTEFIRTAWAAAVTYRGSDKRGGVNGGRIRLEPQKDWEVNNPEQLKKVIKTLEDVQQKFSSGGKKVSFADLVVLAGNAAVEKASGISVPFTPGRTDATQDMTDVQSFEHLKPTRDGFRNYGSGTDRVRTEQFLVDKAHLLNLTAPEMTVLIGGMRALNANWDGSNHGILTKRPGQLTPDFFVNLLDMGVKWQPTDNKNELFDGIERKSGEKKWIATRADLVFGSHAELRAIAEVYGSAGNEEKFKHDFVAAWDKIMMNDRYDVSKHNKTGVYQARL

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAAGGAGTGTCCAATCAAGTTGGCCAATACTGGCGGCGGTGGCACCCGCAACTTCGACTGGTGGCCAGACCAGTTGAGGTTGAACATCCTCCGCCAGCAGACGCCGGTCACGAAC
CCGATGGGTCAGGACTTCGACTATGCTGAGGCGTGGAAGAGCGTAGACTACAAGGCGTTGAAGGAAGATATTCGCCACGTCCTCACAACCTCGCAGGAGTGGTGGCCGGCTGACTTCGGG
CACTATGGCGGGCTCTTTATCCGAATGGCATGGCACTC
GTAAGTGGCACGCTTGGCTGTCTCCTGATGCGAGTCGCAGAACTGACTGCTTTACAGTGCTGGTACATACCGCGTGTTGGAC
GGCCGTGGCGGAGGTGGCGGCGGCCAGCAGCGCTTTGCGCCACTCAACAGCTGGCCCGACAACGTCAGTCTTGACAAGGCCCGCCGGCTATTGTGGCCCGTGAAGCAAAAGTACGGCAAC
AAGGTGTCTTGGGCAGACTTGATGCTGCTCACCGGAAACGTGTCTCTCGAGGACATGGGCCTGCAAACTTTCGGCTTTGCTGGTGGTCGGGCAGATCAGTGGGAGGCTGACGAGTCGGTC
TACTGGGGTGGCGAGACCACCTGGCTCGGCAACGATGTTCGCTACTCTCAAGGTCACGAGGGTTTGGCCGAGGGCGGCGTTGTCGACGGTGACATGCACAAGGTTGATGCCAAGGATATC
CATTCCCGCGATCTCGAGAAGCCAGTTGCTGCATCTCACATGGGCTTGATTTACGTAAACCCGGAAGGCCCTGACGGTATTCCCGACCCGGTTGCGGCTGCCCGTGACATTCGCACCACG
TTCGGCCGCATGGCCATGAACGATTACGAGACTGCAGCGCTCATTATCGGCGGTCACACATTCGGCAAGACTCACGGTGCAGGCTCTGCTGATCATGTTGGCAAGGAGCCGATGGCCGCC
CCCATTGAGAGCCAGGGTCTTGGGTGGAACAGCAAATACAACAGCGGTAGTGGCCGTGACACTATCACCAGTGGTTTAGAGGTCACCTGGACGAAGACACCAACCAAGTGGAGCAACCAC
TATCTCGAGTACCTCTTCAAGTTCGATTGGGAACTCACCAAGAGCCCTGCCGGTGCCAACCAGTGGGAGGCGAAGAACGCAGACAACATGATCCCTGCGGCAGACGGCGACCCGAACAAG
ATGCAGAAGCCGCGTATGTTGACTACCGATCTGTCCATGCGCTACGACAAGGAGTACGAGAAGATCTCGCGCCACTTCCTCGAGCACCCAGATGAGCTGGCAGACGCTTTCGCGCGTACC
TGGTTCAAGCTCCTGCACAGAGACATGGGTCCGCGGACACGCTGGATCGGCCCTGAGATTCCTAAGGAAATCCTGCTTTGGGAGGATCCAGTGCCGAGCGTCGACCACGAGCTTATCAGC
AGCGAGGACGCCAACCAACTAAAGAAGGAGATTCTCGGAACCGGCATCGAGCCAACCGAGTTCATCCGCACTGCATGGGCTGCCGCAGTCACCTATCGTGGCAGCGACAAGCGTGGCGGT
GTCAATGGTGGTCGCATCAGGCTTGAGCCGCAGAAGGACTGGGAGGTCAACAACCCGGAGCAGCTCAAGAAGGTCATCAAGACTCTCGAGGATGTTCAGCAGAAGTTCAGCAGTGGTGGA
AAGAAGGTGTCGTTCGCCGACCTCGTTGTGCTTGCCGGCAACGCTGCCGTGGAGAAGGCCTCCGGCATTTCGGTTCCTTTCACGCCTGGCCGTACCGACGCCACCCAAGACATGACCGAC
GTCCAGTCATTCGAGCACCTTAAGCCAACGCGCGACGGCTTCCGGAACTATGGCAGCGGCACTGACCGTGTTCGCACCGAGCAGTTCCTTGTCGACAAGGCCCACCTGCTCAACCTGACT
GCCCCAGAAATGACGGTGCTCATTGGTGGAATGCGCGCACTCAATGCCAACTGGGACGGCTCTAACCACGGTATTCTTACCAAGCGCCCTGGCCAGCTCACACCAGACTTTTTCGTCAAT
CTTCTCGACATGGGTGTCAAGTGGCAGCCAACCGACAACAAGAACGAGCTGTTCGACGGTATTGAGCGCAAGAGCGGCGAGAAGAAGTGGATCGCCACTCGTGCTGACCTGGTCTTCGGC
TCGCACGCTGAGCTCCGCGCCATTGCCGAGGTGTACGGCAGCGCTGGCAATGAAGAGAAGTTCAAGCATGACTTCGTGGCTGCGTGGGACAAGATCATGATGAATGACCGCTACGACGTG
TCGAAGCATAATAAGACGGGCGTCTACCAAGCTCGCTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAAGGAGTGTCCAATCAAGTTGGCCAATACTGGCGGCGGTGGCACCCGCAACTTCGACTGGTGGCCAGACCAGTTGAGGTTGAACATCCTCCGCCAGCAGACGCCGGTCACGAAC
CCGATGGGTCAGGACTTCGACTATGCTGAGGCGTGGAAGAGCGTAGACTACAAGGCGTTGAAGGAAGATATTCGCCACGTCCTCACAACCTCGCAGGAGTGGTGGCCGGCTGACTTCGGG
CACTATGGCGGGCTCTTTATCCGAATGGCATGGCACTC
TGCTGGTACATACCGCGTGTTGGACGGCCGTGGCGGAGGTGGCGGCGGCCAGCAGCGCTTTGCGCCACTCAACAGCTGGCCC
GACAACGTCAGTCTTGACAAGGCCCGCCGGCTATTGTGGCCCGTGAAGCAAAAGTACGGCAACAAGGTGTCTTGGGCAGACTTGATGCTGCTCACCGGAAACGTGTCTCTCGAGGACATG
GGCCTGCAAACTTTCGGCTTTGCTGGTGGTCGGGCAGATCAGTGGGAGGCTGACGAGTCGGTCTACTGGGGTGGCGAGACCACCTGGCTCGGCAACGATGTTCGCTACTCTCAAGGTCAC
GAGGGTTTGGCCGAGGGCGGCGTTGTCGACGGTGACATGCACAAGGTTGATGCCAAGGATATCCATTCCCGCGATCTCGAGAAGCCAGTTGCTGCATCTCACATGGGCTTGATTTACGTA
AACCCGGAAGGCCCTGACGGTATTCCCGACCCGGTTGCGGCTGCCCGTGACATTCGCACCACGTTCGGCCGCATGGCCATGAACGATTACGAGACTGCAGCGCTCATTATCGGCGGTCAC
ACATTCGGCAAGACTCACGGTGCAGGCTCTGCTGATCATGTTGGCAAGGAGCCGATGGCCGCCCCCATTGAGAGCCAGGGTCTTGGGTGGAACAGCAAATACAACAGCGGTAGTGGCCGT
GACACTATCACCAGTGGTTTAGAGGTCACCTGGACGAAGACACCAACCAAGTGGAGCAACCACTATCTCGAGTACCTCTTCAAGTTCGATTGGGAACTCACCAAGAGCCCTGCCGGTGCC
AACCAGTGGGAGGCGAAGAACGCAGACAACATGATCCCTGCGGCAGACGGCGACCCGAACAAGATGCAGAAGCCGCGTATGTTGACTACCGATCTGTCCATGCGCTACGACAAGGAGTAC
GAGAAGATCTCGCGCCACTTCCTCGAGCACCCAGATGAGCTGGCAGACGCTTTCGCGCGTACCTGGTTCAAGCTCCTGCACAGAGACATGGGTCCGCGGACACGCTGGATCGGCCCTGAG
ATTCCTAAGGAAATCCTGCTTTGGGAGGATCCAGTGCCGAGCGTCGACCACGAGCTTATCAGCAGCGAGGACGCCAACCAACTAAAGAAGGAGATTCTCGGAACCGGCATCGAGCCAACC
GAGTTCATCCGCACTGCATGGGCTGCCGCAGTCACCTATCGTGGCAGCGACAAGCGTGGCGGTGTCAATGGTGGTCGCATCAGGCTTGAGCCGCAGAAGGACTGGGAGGTCAACAACCCG
GAGCAGCTCAAGAAGGTCATCAAGACTCTCGAGGATGTTCAGCAGAAGTTCAGCAGTGGTGGAAAGAAGGTGTCGTTCGCCGACCTCGTTGTGCTTGCCGGCAACGCTGCCGTGGAGAAG
GCCTCCGGCATTTCGGTTCCTTTCACGCCTGGCCGTACCGACGCCACCCAAGACATGACCGACGTCCAGTCATTCGAGCACCTTAAGCCAACGCGCGACGGCTTCCGGAACTATGGCAGC
GGCACTGACCGTGTTCGCACCGAGCAGTTCCTTGTCGACAAGGCCCACCTGCTCAACCTGACTGCCCCAGAAATGACGGTGCTCATTGGTGGAATGCGCGCACTCAATGCCAACTGGGAC
GGCTCTAACCACGGTATTCTTACCAAGCGCCCTGGCCAGCTCACACCAGACTTTTTCGTCAATCTTCTCGACATGGGTGTCAAGTGGCAGCCAACCGACAACAAGAACGAGCTGTTCGAC
GGTATTGAGCGCAAGAGCGGCGAGAAGAAGTGGATCGCCACTCGTGCTGACCTGGTCTTCGGCTCGCACGCTGAGCTCCGCGCCATTGCCGAGGTGTACGGCAGCGCTGGCAATGAAGAG
AAGTTCAAGCATGACTTCGTGGCTGCGTGGGACAAGATCATGATGAATGACCGCTACGACGTGTCGAAGCATAATAAGACGGGCGTCTACCAAGCTCGCTTGTAA

Retrieve as FASTA