Entry information : ZmPrx84 (peroxidase 24)
Entry ID 1008
Creation 2006-06-05 (Christophe Dunand)
Last sequence changes 2006-06-05
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-12-23 (Marie Brette (Scipio))
Peroxidase information: ZmPrx84 (peroxidase 24)
Name (synonym) ZmPrx84 (peroxidase 24)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Endosperm
Meristems
Mixed tissues
Ovaries
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx84
start..stop
S start..stop
SbPrx55 599 0 6..346 4..344
SpPrx02 575 0 2..346 2..346
ZmPrx65 540 0 1..346 1..343
SiPrx11 535 0 33..346 35..347
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 41743329..41743616 288 N° 2 41742059..41742811 753  
complement(join(41742059..41742811,41743329..41743616))


exon

Literature and cross-references ZmPrx84 (peroxidase 24)
Literature REFERENCE 1 Bohnert,H. et al., unpublished.
REFERENCE 2 Duvick,J.P., Maddox,J.R., Navarro Acevedo,P.A. and Simmons,C.R. Maize peroxidase genes and their use for improving plant disease resistance and stalk strength
Protein ref. UniProtKB:   B6SIU4   B6SRH9 [Other strain]
DNA ref. GenBank:   AX546771 [Mismatch]   AX546771.1 [Mismatch]   AC182628.3 (50390..51944)
mRNA ref. GenBank:   AY109037.1
Cluster/Prediction ref. UniGene:   Zm.79249
Protein sequence: ZmPrx84 (peroxidase 24)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346 (304)
PWM (Da):   %s   36381.24 (31848.0) Transmb domain:   %s   i23-45o
PI (pH):   %s   8.55 (8.19) Peptide Signal:   %s   cut: 43 range:43-346
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRGQTQTASAGGRWRGDGAAAWCWWWVAVVLLLGHLPSCARAGLLESNPGLAYNFYKNSCPSVDSIVRSVTWAQVAANPALPARLLRLHFHDCFVKGCDASILLDTAQSEKTAAPNLSVGGYEVIDAIKAQLERACPGVVSCADIVALAARDAVSYQFKASLWQVETGRRDGTVSLASNTGALPSPFAGFAGLLQSFSDRGLNLTDLVALSGAHTIGVASCSSVTPRLYQGNASSVDPLLDSAYARTLMSSCPNPSPASATVALDGGTPFRFDSGYYTRVQQRQGTLASDAALAQNAAAAQMVADLTNPIKFYAAFSMSMKKMGRVDVLTGANGQIRKQCRQVNTS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 3, introns 1), 2 mRNA and 160 ESTs. Two separated TGI compiles.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGGGGCAAACGCAGACAGCTTCCGCGGGGGGCCGGTGGCGAGGCGACGGCGCTGCGGCGTGGTGTTGGTGGTGGGTGGCCGTGGTCCTCCTGCTTGGCCATTTACCGAGCTGCGCG
CGCGCGGGGCTGCTGGAGTCCAACCCGGGCCTGGCCTACAACTTCTACAAGAACAGCTGCCCCAGCGTGGACTCCATCGTCCGCAGCGTCACCTGGGCGCAGGTCGCCGCCAACCCTGCC
CTCCCGGCTCGCCTCCTCCGCCTCCACTTCCATGACTGCTTCGTCAAG
GTGCGTCCGTCCGTCCGCGCTGTGCTCTCTGTGTCCGTCGACCTTTCTTTCTTTCATTCATTCATTCAGGGT
CAGAGCAGTCAGTCAGTGGGCACCAAGCGCACTTTTGTCGGTTTTTTTACTGACGACAAAGCAGAGCGCTGCAGAACAGCAGTGTTGAAGTCGACCCTCTCTCCTCGTGTTCTGCTCTTA
CGCGGAATACGTAAGCATTACGGCAACACCTCCTCGGGTTGGCGCGCCCACAGACACATGACAGGACGACGGGGGAAAAAAAGAAAATACTCCACGTACTAGTACTACTACGCCGCGCCG
GGGGCAACGCGAATCTTGTCATTTTGCCCCCCCGGACCCCGCTCTCCCGTACGGCGGTCGGCTTGGATGTCGATTGGGGAGGGGAGGGGAGGGGAGGGACGGGGGCGCGTTCGTGCCGCG
TCCTGTCCTTGTCGCGTCCGTCGTTCGTCGGTCGCCAACGCCGTGACCCCATCCTGCAACTGACCACCAGCTGCTTCTGACGCAGGGCTGCGACGCGTCGATCCTGCTGGACACCGCGCA
GAGCGAGAAGACGGCGGCGCCGAACCTGTCGGTGGGCGGGTACGAGGTGATCGACGCGATCAAGGCGCAGCTGGAGAGGGCGTGCCCGGGCGTGGTGTCGTGCGCCGACATCGTGGCGCT
GGCGGCGCGCGACGCCGTGTCGTACCAGTTCAAGGCGTCGCTGTGGCAGGTGGAGACGGGGCGGCGCGACGGCACGGTGTCGCTGGCGTCCAACACGGGGGCGCTGCCGTCGCCCTTCGC
GGGCTTCGCGGGCCTGCTGCAGAGCTTCTCGGACCGGGGGCTGAACCTGACGGACCTCGTGGCGCTGTCGGGGGCGCACACCATCGGCGTGGCAAGCTGCTCCAGCGTCACCCCGCGCCT
GTACCAGGGGAACGCCAGCAGCGTGGACCCGCTGCTGGACTCGGCCTACGCGCGGACGCTCATGTCGTCGTGCCCCAACCCGTCGCCGGCGTCGGCCACCGTGGCGCTGGACGGCGGCAC
GCCGTTCCGGTTCGACAGCGGGTACTACACCAGGGTGCAGCAGAGGCAGGGCACGCTGGCCTCCGACGCCGCGCTGGCGCAGAACGCCGCCGCCGCGCAGATGGTGGCCGACCTCACCAA
CCCCATCAAGTTCTACGCCGCCTTCTCCATGTCCATGAAGAAGATGGGCCGCGTCGACGTGCTCACCGGCGCAAACGGCCAGATCAGGAAGCAGTGCCGCCAGGTCAACACCTCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGGGGCAAACGCAGACAGCTTCCGCGGGGGGCCGGTGGCGAGGCGACGGCGCTGCGGCGTGGTGTTGGTGGTGGGTGGCCGTGGTCCTCCTGCTTGGCCATTTACCGAGCTGCGCG
CGCGCGGGGCTGCTGGAGTCCAACCCGGGCCTGGCCTACAACTTCTACAAGAACAGCTGCCCCAGCGTGGACTCCATCGTCCGCAGCGTCACCTGGGCGCAGGTCGCCGCCAACCCTGCC
CTCCCGGCTCGCCTCCTCCGCCTCCACTTCCATGACTGCTTCGTCAAG
GGCTGCGACGCGTCGATCCTGCTGGACACCGCGCAGAGCGAGAAGACGGCGGCGCCGAACCTGTCGGTGGGC
GGGTACGAGGTGATCGACGCGATCAAGGCGCAGCTGGAGAGGGCGTGCCCGGGCGTGGTGTCGTGCGCCGACATCGTGGCGCTGGCGGCGCGCGACGCCGTGTCGTACCAGTTCAAGGCG
TCGCTGTGGCAGGTGGAGACGGGGCGGCGCGACGGCACGGTGTCGCTGGCGTCCAACACGGGGGCGCTGCCGTCGCCCTTCGCGGGCTTCGCGGGCCTGCTGCAGAGCTTCTCGGACCGG
GGGCTGAACCTGACGGACCTCGTGGCGCTGTCGGGGGCGCACACCATCGGCGTGGCAAGCTGCTCCAGCGTCACCCCGCGCCTGTACCAGGGGAACGCCAGCAGCGTGGACCCGCTGCTG
GACTCGGCCTACGCGCGGACGCTCATGTCGTCGTGCCCCAACCCGTCGCCGGCGTCGGCCACCGTGGCGCTGGACGGCGGCACGCCGTTCCGGTTCGACAGCGGGTACTACACCAGGGTG
CAGCAGAGGCAGGGCACGCTGGCCTCCGACGCCGCGCTGGCGCAGAACGCCGCCGCCGCGCAGATGGTGGCCGACCTCACCAACCCCATCAAGTTCTACGCCGCCTTCTCCATGTCCATG
AAGAAGATGGGCCGCGTCGACGTGCTCACCGGCGCAAACGGCCAGATCAGGAAGCAGTGCCGCCAGGTCAACACCTCCTGA

Retrieve as FASTA