Entry information : OsPrx01 (OS01G07770 / LOC_Os01g07770.1)
Entry ID 1011
Creation 2006-07-17 (Filippo Passardi)
Last sequence changes 2006-07-17 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-08-07 (Christophe Dunand)
Peroxidase information: OsPrx01 (OS01G07770 / LOC_Os01g07770.1)
Name (synonym) OsPrx01 (OS01G07770 / LOC_Os01g07770.1)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx01
start..stop
S start..stop
BdiPrx50 580 0 1..326 1..326
SbPrx51 555 0 1..326 1..331
SiPrx18 553 0 1..326 1..327
AcoPrx83 472 2e-169 27..326 24..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3731150..3731365 216 N° 2 3731445..3731624 180 N° 3 3731731..3731893 163 N° 4 3732509..3732930 422
join(3731150..3731365,3731445..3731624,3731731..3731893,3732509..3732930)


exon

Literature and cross-references OsPrx01 (OS01G07770 / LOC_Os01g07770.1)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants. Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5VR15
DNA ref. GenBank:   NC_008394.1 (3731150..3732927)
Protein sequence: OsPrx01 (OS01G07770 / LOC_Os01g07770.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (302)
PWM (Da):   %s   34783.49 (32145.1)  
PI (pH):   %s   6.88 (6.74) Peptide Signal:   %s   cut: 25 range:25-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAISEMSALFFLFSALLRSSLVHSQGLQIGFYDNNCPDAEDIVRSTVEKYYNNDATIAPGLLRLHFHDCFVQGCDASVLISGASSERTAPQNFGIRGFEVIDDAKSQLEAVCSGVVSCADILALAARDAVDLTGGPSWSVPLGRRDGRISSASDAKALPSPADPVSVQRQKFAAQGLTDRELVTLVGAHTIGQTDCIFFRYRLYNFTATGNADPTISPSALPQLRALCPPAGDGSRRVALDLGSPGAFDVSFFKNVRDGGAVLESDQRLWGDAATQAAVQSFAGNVRGLFGLRFSYEFPKAMVRMSSIAVKTGSQGEIRRKCSKFN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns). No ESTs found (NIAS DNA bank and TIGR)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATATCAGAAATGTCAGCTCTTTTCTTTCTATTTAGTGCTTTGCTAAGAAGTTCTTTGGTCCACAGTCAAGGATTGCAGATAGGGTTTTATGATAATAATTGCCCTGATGCTGAG
GACATAGTCAGGTCTACCGTCGAAAAGTATTACAACAATGATGCAACCATAGCCCCAGGCTTGCTCAGGCTACATTTCCATGACTGTTTTGTTCAA
GTTAGTTTCCTTCATCCATATAGT
GTTAATCTGGATCTCATGTTTTTATGCCTGACATTTGTTTCTACCTGTTTTGTAGGGATGTGATGCGTCAGTTTTGATTTCAGGTGCATCCTCTGAGAGGACTGCACCACAGAATTTTGG
TATCAGGGGGTTTGAAGTGATAGATGATGCTAAGTCCCAGTTGGAAGCCGTATGCTCCGGGGTGGTATCCTGTGCTGATATATTGGCTCTCGCTGCACGCGATGCCGTTGATTTG
GTGAG
AAACTCAGCTCCTGTGCAGAATTCCTGCTGAGAACTGTCGATTACCTTTTGATTAATTCAGACCTTAATAACTGAATTTCTTGTTTTGTACTTACTGCAAGACCGGTGGGCCAAGCTGGT
CAGTCCCACTGGGACGGAGAGATGGAAGAATTTCATCAGCTTCAGATGCCAAAGCCTTGCCGTCTCCGGCTGATCCTGTATCTGTTCAGAGGCAAAAATTTGCAGCTCAAGGCCTGACGG
ACCGTGAGCTCGTAACACTAGTTG
GTAAATCTTCCTCCATTCTTGCTTAATCATGCCCGATACACACAATTATATTTATCAATCAGTGAACAATTTGTGTCTCATTTTGTCATGAGCCAA
ACTCAGCCCTCCATTTGAAACAGATTATTAATCGGATGATTGCTGTGGATTATCTACTTGATTATGGTGATAAACAAAATATTTAAGAAATAAACTTAACATGTAACTTAGAATAAATAA
ATGGTCTATACAGTACTCCATCCGTTTTAGATTATAAGTCATTTAACTTTGGTCAAAGTCAAACTACTTTAAGATTTGACTAAGTTTATAAGAAAAATAATAACATACTCAACACAAGAT
AAAAATATTATAAAAATATATTCATCTATAGATTTAATAAAACAAATTTGTTATTGTAGATATTAATATATTTGTTTGTAAATTTGGTCAAACTTAATGTAGTTTAACTTTGACTAAAGT
TAAAACGACTTATAATCAAACGGAGGTAATACAATATAATAAACTTATTTTAAGCAAACATATTTTTAGTGGCATGGAGCCTATAATTCGATGAAGTAGGTTTATACTCCACTGCTAATG
CTAACCCTGTGTGTGGTTCACTGATCTCTGTAACTGTAGGTGCTCACACCATCGGGCAGACGGACTGCATCTTTTTCCGGTACCGGCTCTACAACTTCACGGCGACGGGGAACGCGGACC
CGACGATCAGCCCGTCGGCGCTGCCGCAGCTGCGGGCGCTGTGCCCGCCCGCCGGCGACGGCTCCCGGCGCGTGGCGCTGGACCTGGGCAGCCCGGGGGCGTTCGACGTGAGCTTCTTCA
AGAACGTCAGGGACGGCGGCGCCGTGCTGGAGTCCGACCAGCGGCTGTGGGGCGACGCCGCGACGCAGGCCGCCGTGCAGAGCTTCGCCGGCAACGTCAGGGGGCTCTTCGGCCTCCGGT
TCAGCTACGAGTTCCCCAAGGCCATGGTCAGGATGAGCAGCATCGCCGTCAAGACCGGCAGCCAGGGCGAGATCAGGAGGAAGTGCTCCAAGTTCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATATCAGAAATGTCAGCTCTTTTCTTTCTATTTAGTGCTTTGCTAAGAAGTTCTTTGGTCCACAGTCAAGGATTGCAGATAGGGTTTTATGATAATAATTGCCCTGATGCTGAG
GACATAGTCAGGTCTACCGTCGAAAAGTATTACAACAATGATGCAACCATAGCCCCAGGCTTGCTCAGGCTACATTTCCATGACTGTTTTGTTCAA
GGATGTGATGCGTCAGTTTTGATT
TCAGGTGCATCCTCTGAGAGGACTGCACCACAGAATTTTGGTATCAGGGGGTTTGAAGTGATAGATGATGCTAAGTCCCAGTTGGAAGCCGTATGCTCCGGGGTGGTATCCTGTGCTGAT
ATATTGGCTCTCGCTGCACGCGATGCCGTTGATTTG
ACCGGTGGGCCAAGCTGGTCAGTCCCACTGGGACGGAGAGATGGAAGAATTTCATCAGCTTCAGATGCCAAAGCCTTGCCGTCT
CCGGCTGATCCTGTATCTGTTCAGAGGCAAAAATTTGCAGCTCAAGGCCTGACGGACCGTGAGCTCGTAACACTAGTTG
GTGCTCACACCATCGGGCAGACGGACTGCATCTTTTTCCGG
TACCGGCTCTACAACTTCACGGCGACGGGGAACGCGGACCCGACGATCAGCCCGTCGGCGCTGCCGCAGCTGCGGGCGCTGTGCCCGCCCGCCGGCGACGGCTCCCGGCGCGTGGCGCTG
GACCTGGGCAGCCCGGGGGCGTTCGACGTGAGCTTCTTCAAGAACGTCAGGGACGGCGGCGCCGTGCTGGAGTCCGACCAGCGGCTGTGGGGCGACGCCGCGACGCAGGCCGCCGTGCAG
AGCTTCGCCGGCAACGTCAGGGGGCTCTTCGGCCTCCGGTTCAGCTACGAGTTCCCCAAGGCCATGGTCAGGATGAGCAGCATCGCCGTCAAGACCGGCAGCCAGGGCGAGATCAGGAGG
AAGTGCTCCAAGTTCAACTAG

Retrieve as FASTA