Entry information : TterCP02 (TterKatG2)
Entry ID 10112
Creation 2012-01-06 (Christophe Dunand)
Last sequence changes 2012-05-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-05-10 (Christophe Dunand)
Peroxidase information: TterCP02 (TterKatG2)
Name (synonym) TterCP02 (TterKatG2)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Chaetomiaceae Thielavia
Organism Thielavia terrestris (Acremonium alabamense)    [TaxId: 35720 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TterCP02
start..stop
S start..stop
AmacrCP01 1196 0 1..789 1..782
OmaiCP02 1179 0 1..789 1..777
MvarCP01 1166 0 1..789 1..783
MbicCP01 1160 0 1..789 1..780
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8579267..8579582 316 N° 2 8579647..8579801 155 N° 3 8579876..8580524 649 N° 4 8580606..8580845 240
N° 5 8580920..8581242 323 N° 6 8581326..8582015 690  
join(8579267..8579582,8579647..8579801,8579876..8580524,8580606..8580845,8580920 ..8581242,8581326..8582015)


exon

Literature and cross-references TterCP02 (TterKatG2)
Literature Berka R.M., Tsang A. et al., unpublished since 2011
DNA ref. JGI genome:   chromosome_2 (8579267..8582015)
EST ref. GenBank:   GR257486.1 [Fragment]   GR257487.1 [Fragment]
Protein sequence: TterCP02 (TterKatG2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   791 (772)
PWM (Da):   %s   85187.28 (83229.2)  
PI (pH):   %s   5.51 (5.18) Peptide Signal:   %s   cut: 19 range:19-790
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVASKRYVLAGLLAQASAQGCPYAAAAAAANKRDILAVRADEPSLDTLAHSFGKCAQLSDAAGGGTRSRDWWPCQLRLDVLRQFSPEQNPLGADFDYAAAFATLDYNGLKADLKALLTQSQAWWPADFGNYGGLLIRMAWHSAGTYRIVDGRGGGGMGQQRFAPLNSWPDNANLDKARRLLWPIKQKYGSAISWADLMILAGNVALETMGVPLLGFGGGRVDTWQSDESVYWGSETTFVPEGNDIRYNGSTDYAARASRLQEPLAATHMGLIYVNPEGPDATGDPKLAALDIRTAFGRMGMNDSETVALIAGGHAFGKTHGASGTALGPPPEAAPLEAQDLGWYNSFGTGNADDTITSGTEVIWSKTPTRWSNGFLNSLFKNEWTLVKSPAGALQFEALNGTRDYPDPFNKTFRRPTMLVTDLALREDPTYRAIAEKWVDDFQGLTDAFAAAWFKLTHRDMGPVSRYLGPEVPKQRFIWQDPLPEAKYPPISEADQEVLKAQILKAPGVNVSSLVAVAWGSASTFRGGDKRGGANGARIALEPQVSWEVNNPKQLRVVLDALTDIKDAFNKKSRTTQVSLADLIVLAGNAAIESAIPATTKAKVKVPFTPGRVDATQADTDPASFAYLLPQADGFRNWRNASAGGAWALASTEALLVDRAQQLTLTAPELVALVGGLRALGAVWDNSARGVLTARPGTLTNDFFVNLLDMETVWTADEGSGGELFTGRDRATGKVRWQATRADLVFGAQAELRAIAEVYAEAGGQERLVADFVKAWAKVMDLDRFDVKKK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns) AND 2 ESTS. Strain="NRRL 8126". Signal sequence for secretion (predicted) - 18 amino acids from the N-terminus.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGGCCTCGAAGCGTTACGTGCTCGCCGGGCTCCTGGCGCAGGCCTCGGCCCAGGGATGCCCCTATGCCGCCGCCGCCGCCGCCGCCAACAAGCGGGATATCTTGGCCGTGAGGGCC
GACGAGCCGTCGCTAGACACGCTCGCCCACTCGTTCGGCAAGTGTGCGCAGCTCAGCGACGCGGCCGGCGGAGGGACGAGGAGCCGCGACTGGTGGCCGTGCCAGCTGAGGCTGGACGTG
CTGCGCCAGTTCTCGCCCGAGCAGAACCCGTTGGGGGCCGACTTCGACTACGCTGCCGCTTTTGCTACGCTGGACT
GTACGTTTTGAATTCGCTTTGGAGTTGTCGATGGAGAAATGACC
TGACGCAGCTCTTTTCCAAGATAACGGACTCAAGGCCGACCTCAAGGCGCTGCTGACGCAGTCGCAGGCTTGGTGGCCGGCCGACTTTGGCAACTATGGCGGTCTGCTCATTCGCATGGC
CTGGCACAGCGCCGGCACTTACCGCATCGTCGACGGGCGGGGTGGCGGCGGCATG
GTATGAGCGTCCCCTTTCCCTCCCGCTTGCTCCCCAGGGGCTGACCACCGTGTTCACTCGCCTCG
TGCATACAGGGCCAGCAGCGGTTCGCCCCGCTCAACAGCTGGCCCGACAACGCCAACCTGGACAAGGCGCGGCGCCTGCTGTGGCCCATCAAGCAGAAGTACGGCAGCGCCATCTCGTGG
GCCGACCTGATGATCCTGGCCGGCAACGTTGCGCTCGAGACCATGGGCGTCCCCCTGCTTGGCTTCGGCGGCGGCCGCGTCGACACCTGGCAGTCGGACGAGAGCGTCTACTGGGGCAGC
GAGACCACCTTCGTGCCCGAGGGCAACGACATCCGCTACAACGGCAGCACCGACTACGCCGCGCGCGCCAGCCGCCTGCAGGAGCCGCTCGCCGCCACCCACATGGGCCTGATCTACGTC
AACCCGGAGGGCCCCGACGCGACCGGCGACCCCAAGCTGGCCGCCCTGGACATCCGCACCGCCTTCGGCCGCATGGGCATGAACGACTCGGAGACCGTCGCCCTGATCGCCGGCGGCCAC
GCGTTTGGCAAGACGCACGGCGCGTCGGGCACAGCCCTCGGTCCTCCACCGGAAGCAGCGCCCCTCGAGGCCCAGGATCTCGGCTGGTACAACAGCTTCGGCACTGGCAACGCCGACGAC
ACCATCACCAGCGGAACGGAGGTTATTTGGTCCAAGACGCCCACGAGATGGAGTAATG
GTAATCAAATCCTTCCTCTGCTTTTTTCCTGCATTGCTCGTCCGCGCCAGGTTCACGCACTC
ATCTGATCCCCCCTGGCAGGCTTCCTGAACAGCCTCTTCAAGAACGAGTGGACGCTGGTTAAGAGCCCGGCCGGCGCCCTCCAGTTCGAGGCGCTCAACGGCACGCGCGACTACCCCGAC
CCGTTCAACAAGACCTTCCGGCGCCCCACCATGCTGGTCACCGACCTGGCCCTGCGCGAGGACCCCACCTACAGAGCCATTGCCGAGAAGTGGGTGGATGACTTCCAGGGCCTCACCGAT
GCCTTCGCGGCCGCTTGGT
GTAAGTCGTTCCGCCAGTCCTTTGTTTTCTTACCAACCATAATGAGCTAACTCGGACGCGACCGGCGTCTCTAGTCAAGCTCACGCACCGCGACATGGGCC
CCGTCTCGCGCTACCTCGGGCCCGAGGTGCCCAAGCAGCGCTTCATCTGGCAGGATCCGCTGCCCGAGGCGAAGTACCCGCCCATCAGCGAGGCCGACCAGGAGGTGCTCAAGGCGCAGA
TCCTGAAGGCGCCCGGCGTGAACGTGTCGAGCCTCGTGGCCGTCGCCTGGGGCTCCGCCTCGACCTTCCGCGGCGGCGACAAGCGCGGCGGGGCCAACGGCGCGCGCATCGCCCTCGAGC
CGCAGGTCTCCTGGGAGGTGAACAACCCGAAGCAGCTGCGGGTTGTCCTGGATGCC
GTACGTTTTCCTTCTGTATTGTTAATTCATCCGCGGCGGCCAAACAAACTAACCAACTAACCCC
ATCCCTCCCTACCTCCCAGTTAACCGACATCAAAGACGCCTTCAACAAAAAGTCGCGCACCACCCAGGTCTCCCTGGCGGACCTGATCGTCCTGGCCGGCAACGCAGCCATCGAGTCCGC
CATCCCGGCCACCACCAAAGCCAAAGTCAAAGTCCCCTTCACCCCCGGCCGCGTGGACGCGACGCAGGCCGACACCGACCCAGCGAGCTTCGCCTACCTCCTGCCGCAGGCCGACGGCTT
CCGCAACTGGCGCAACGCGAGCGCCGGCGGCGCCTGGGCGCTCGCCAGCACCGAGGCGCTGCTGGTCGACCGCGCGCAGCAGCTGACGCTGACCGCGCCGGAGCTGGTCGCGCTCGTCGG
CGGGCTGCGCGCGCTGGGCGCCGTCTGGGACAACTCCGCGCGGGGGGTGCTCACGGCGCGGCCTGGCACGCTGACGAATGATTTCTTTGTGAATTTGTTGGATATGGAGACCGTGTGGAC
CGCCGACGAGGGCAGCGGCGGCGAGCTGTTTACCGGGCGCGACAGGGCGACCGGGAAGGTGCGCTGGCAGGCTACGAGGGCGGATCTGGTTTTTGGTGCGCAGGCCGAGTTGAGGGCGAT
TGCGGAGGTGTATGCCGAGGCGGGCGGGCAGGAGAGGTTGGTGGCGGACTTTGTGAAGGCGTGGGCCAAGGTGATGGATCTGGATCGGTTTGATGTCAAGAAGAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGGCCTCGAAGCGTTACGTGCTCGCCGGGCTCCTGGCGCAGGCCTCGGCCCAGGGATGCCCCTATGCCGCCGCCGCCGCCGCCGCCAACAAGCGGGATATCTTGGCCGTGAGGGCC
GACGAGCCGTCGCTAGACACGCTCGCCCACTCGTTCGGCAAGTGTGCGCAGCTCAGCGACGCGGCCGGCGGAGGGACGAGGAGCCGCGACTGGTGGCCGTGCCAGCTGAGGCTGGACGTG
CTGCGCCAGTTCTCGCCCGAGCAGAACCCGTTGGGGGCCGACTTCGACTACGCTGCCGCTTTTGCTACGCTGGACT
ATAACGGACTCAAGGCCGACCTCAAGGCGCTGCTGACGCAGTCG
CAGGCTTGGTGGCCGGCCGACTTTGGCAACTATGGCGGTCTGCTCATTCGCATGGCCTGGCACAGCGCCGGCACTTACCGCATCGTCGACGGGCGGGGTGGCGGCGGCATG
GGCCAGCAG
CGGTTCGCCCCGCTCAACAGCTGGCCCGACAACGCCAACCTGGACAAGGCGCGGCGCCTGCTGTGGCCCATCAAGCAGAAGTACGGCAGCGCCATCTCGTGGGCCGACCTGATGATCCTG
GCCGGCAACGTTGCGCTCGAGACCATGGGCGTCCCCCTGCTTGGCTTCGGCGGCGGCCGCGTCGACACCTGGCAGTCGGACGAGAGCGTCTACTGGGGCAGCGAGACCACCTTCGTGCCC
GAGGGCAACGACATCCGCTACAACGGCAGCACCGACTACGCCGCGCGCGCCAGCCGCCTGCAGGAGCCGCTCGCCGCCACCCACATGGGCCTGATCTACGTCAACCCGGAGGGCCCCGAC
GCGACCGGCGACCCCAAGCTGGCCGCCCTGGACATCCGCACCGCCTTCGGCCGCATGGGCATGAACGACTCGGAGACCGTCGCCCTGATCGCCGGCGGCCACGCGTTTGGCAAGACGCAC
GGCGCGTCGGGCACAGCCCTCGGTCCTCCACCGGAAGCAGCGCCCCTCGAGGCCCAGGATCTCGGCTGGTACAACAGCTTCGGCACTGGCAACGCCGACGACACCATCACCAGCGGAACG
GAGGTTATTTGGTCCAAGACGCCCACGAGATGGAGTAATG
GCTTCCTGAACAGCCTCTTCAAGAACGAGTGGACGCTGGTTAAGAGCCCGGCCGGCGCCCTCCAGTTCGAGGCGCTCAAC
GGCACGCGCGACTACCCCGACCCGTTCAACAAGACCTTCCGGCGCCCCACCATGCTGGTCACCGACCTGGCCCTGCGCGAGGACCCCACCTACAGAGCCATTGCCGAGAAGTGGGTGGAT
GACTTCCAGGGCCTCACCGATGCCTTCGCGGCCGCTTGGT
TCAAGCTCACGCACCGCGACATGGGCCCCGTCTCGCGCTACCTCGGGCCCGAGGTGCCCAAGCAGCGCTTCATCTGGCAG
GATCCGCTGCCCGAGGCGAAGTACCCGCCCATCAGCGAGGCCGACCAGGAGGTGCTCAAGGCGCAGATCCTGAAGGCGCCCGGCGTGAACGTGTCGAGCCTCGTGGCCGTCGCCTGGGGC
TCCGCCTCGACCTTCCGCGGCGGCGACAAGCGCGGCGGGGCCAACGGCGCGCGCATCGCCCTCGAGCCGCAGGTCTCCTGGGAGGTGAACAACCCGAAGCAGCTGCGGGTTGTCCTGGAT
GCC
TTAACCGACATCAAAGACGCCTTCAACAAAAAGTCGCGCACCACCCAGGTCTCCCTGGCGGACCTGATCGTCCTGGCCGGCAACGCAGCCATCGAGTCCGCCATCCCGGCCACCACC
AAAGCCAAAGTCAAAGTCCCCTTCACCCCCGGCCGCGTGGACGCGACGCAGGCCGACACCGACCCAGCGAGCTTCGCCTACCTCCTGCCGCAGGCCGACGGCTTCCGCAACTGGCGCAAC
GCGAGCGCCGGCGGCGCCTGGGCGCTCGCCAGCACCGAGGCGCTGCTGGTCGACCGCGCGCAGCAGCTGACGCTGACCGCGCCGGAGCTGGTCGCGCTCGTCGGCGGGCTGCGCGCGCTG
GGCGCCGTCTGGGACAACTCCGCGCGGGGGGTGCTCACGGCGCGGCCTGGCACGCTGACGAATGATTTCTTTGTGAATTTGTTGGATATGGAGACCGTGTGGACCGCCGACGAGGGCAGC
GGCGGCGAGCTGTTTACCGGGCGCGACAGGGCGACCGGGAAGGTGCGCTGGCAGGCTACGAGGGCGGATCTGGTTTTTGGTGCGCAGGCCGAGTTGAGGGCGATTGCGGAGGTGTATGCC
GAGGCGGGCGGGCAGGAGAGGTTGGTGGCGGACTTTGTGAAGGCGTGGGCCAAGGTGATGGATCTGGATCGGTTTGATGTCAAGAAGAAGTAG

Retrieve as FASTA