Entry information : OmaiCP02 (OmaiKatG2)
Entry ID 10114
Creation 2012-01-06 (Christophe Dunand)
Last sequence changes 2012-01-06 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: OmaiCP02 (OmaiKatG2)
Name (synonym) OmaiCP02 (OmaiKatG2)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Leotiomycetes Myxotrichaceae Oidiodendron
Organism Oidiodendron maius    [TaxId: 78148 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OmaiCP02
start..stop
S start..stop
AmacrCP01 1335 0 1..777 1..782
MvarCP01 1297 0 1..776 1..782
MbicCP01 1278 0 1..777 1..780
TterCP02 1169 0 1..777 1..789
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 469705..470008 304 N° 2 470067..470221 155 N° 3 470295..470799 505 N° 4 470865..471008 144
N° 5 471076..471315 240 N° 6 471384..471706 323 N° 7 471773..472438 666  
join(469705..470008,470067..470221,470295..470799,470865..471008,471076..471315, 471384..471706,471773..472438)


exon

Literature and cross-references OmaiCP02 (OmaiKatG2)
DNA ref. JGI genome:   scaffold_11 (469705..472438)
Cluster/Prediction ref. JGI gene:   146943
Protein sequence: OmaiCP02 (OmaiKatG2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   779 (760)
PWM (Da):   %s   83701.08 (81691.9)  
PI (pH):   %s   5.76 (5.42) Peptide Signal:   %s   cut: 19 range:19-778
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPSIRTLLIGLLPLVSAQGCPYASVNKRDLLVARGDEPSLTTLADSFGKCPTISDAAGGGTRSRDWWPCQLRLDVLRQFSPEQNPLGGSFDYTAAFATLDINALKADIISLLTDSQSWWPADFGHYGGLFIRLAWHSAGTYRAVDGRGGGGMGQQRFAPLNSWPDNANLDKARRLLWPIKQKYGKSISWADLLLFTGNTALEQMGVPILGFGFGRPDTWQADESPFWGAETTFVPEGNDIRYNGSTDFAARANKLEEPLAATHMGLIYVNPQGPNGNGDPKTSALDIREAFGRMGMNDSETVALIAGGHAFGKTHGASTTTLGPPPEGGSIEQQDLGWANSFGTGNADDTITSGLEVIWSKTPTNWTNGFLNSLFKNTWTLVNSPAGAVQFEALNGTVDYPDPFNKTFRHATMLVSDLALREDPTFSAIAESWVNNFEALTNAFVAAWFKLLHRDMGPISRYLGPDVPKQQFIWQDPLPAATGSPITAGDQANLKSQILAARGITVSNLVSVAWGSASTFRGGDKRGGANGARIALQPQASWAVNNPKQLQTVLSALTTIKNNFNKGGRKVSLADLIVLGGNAAVEKAAAAAGSKISVPFTVGRVDATQDNTDISTFENLNPQGDGFRNYRNSSGWSLARTEELLVDKAQQLTLTAPEMTVLVGGMRAINANFDGSSNGILTKRPGTLTNDFFTNLLDINTVWTPDSTNQLFTGKDRSTGAQKWTATRADLVFSSHAELRAISEVYAEAGGASQMVTDFVAAWAKVMDLDRFDVKKY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACCATCAATCCGGACCCTACTGATTGGACTTCTGCCTCTTGTCTCTGCCCAAGGCTGTCCCTATGCCAGCGTGAACAAGCGAGACCTTTTAGTTGCGAGAGGGGACGAGCCGTCC
CTCACAACACTAGCAGACTCTTTCGGCAAATGCCCAACCATCAGCGATGCAGCTGGCGGCGGGACCCGGAGTCGTGACTGGTGGCCATGTCAGTTGCGGCTAGATGTACTGCGTCAATTC
TCGCCGGAGCAGAACCCACTCGGGGGTAGCTTCGACTATACCGCGGCTTTCGCTACGCTGGACA
GTATGTTCAAATGCACGCCTTGACTAGTATTGGCTGCAAAATGACTGACACAGTGT
AGTTAATGCACTCAAAGCAGACATCATATCGTTGTTGACGGACTCGCAGTCTTGGTGGCCGGCAGACTTTGGCCATTATGGCGGTCTGTTTATTCGTCTGGCATGGCACAGTGCTGGTAC
ATACCGAGCTGTCGATGGACGTGGTGGTGGTGGCATG
GTGTGTAACCCCCCCTTTACCCCCACCCCGACTCTGCCTTGAACCGGCACTAACAGCCACGTTCCCTTCCTAGGGCCAACAAC
GCTTCGCTCCACTCAACAGCTGGCCTGATAACGCCAATCTCGACAAAGCACGGCGTCTGCTATGGCCTATCAAGCAGAAGTATGGCAAATCCATCTCGTGGGCCGACTTGCTCCTCTTTA
CCGGCAACACAGCCCTTGAACAAATGGGTGTCCCGATCCTTGGTTTTGGTTTCGGTCGTCCCGATACGTGGCAAGCGGATGAGAGCCCTTTCTGGGGCGCAGAGACCACCTTCGTACCCG
AAGGAAACGACATCCGCTACAATGGTAGCACTGACTTTGCTGCGCGCGCCAACAAGCTCGAGGAGCCACTTGCCGCCACTCACATGGGTCTAATCTACGTAAACCCCCAGGGCCCCAACG
GCAACGGTGATCCTAAGACATCGGCCCTTGACATTCGTGAAGCCTTCGGCCGAATGGGGATGAACGACTCTGAGACTGTGGCCCTGATCGCTGGTGGCCACGCATTTGGAAAGACGCATG
GCGCGTCTACCACTA
GTGAGATTTTTTCTTTGTGCCCCCGGATCTCTCAAAACAACCATCTGTGCTAACGTGTGCTCCAGCCTTGGGCCCTCCGCCGGAAGGCGGCTCTATTGAGCAGCA
GGACTTGGGCTGGGCCAACAGCTTTGGCACTGGCAACGCTGATGATACCATCACCAGTGGATTGGAAGTTATCTGGTCCAAGACGCCAACGAATTGGACCAATG
GTGAACATCCCGCTTT
ACCTTCCCCCTGTTCATATCGGCCCCATAAGCTAACTCGGGCTCTTTCTAGGCTTCCTGAACAGTCTTTTCAAGAACACATGGACTCTAGTTAACAGCCCTGCCGGCGCCGTTCAATTCG
AGGCATTAAACGGCACTGTTGACTACCCTGATCCTTTCAACAAGACATTCCGCCACGCAACTATGCTGGTCAGCGATCTTGCCTTGCGCGAGGATCCTACATTCAGCGCTATTGCCGAGT
CCTGGGTGAACAACTTCGAGGCTCTCACCAATGCCTTTGTGGCTGCATGGT
GTAAGTGTGTACTTCTTAGCTCTTCCTGCCGTGACTTCCTCATTTTGACTTACTATGGGAAATAACAGT
CAAACTCCTGCACCGCGATATGGGTCCCATCTCCCGCTACCTCGGCCCGGACGTGCCCAAACAGCAGTTCATCTGGCAGGATCCTCTCCCTGCTGCGACAGGTTCCCCAATCACCGCCGG
CGACCAGGCGAATCTAAAATCGCAAATCCTCGCCGCCCGGGGCATTACCGTCTCGAACTTGGTCTCTGTCGCCTGGGGTTCTGCCTCGACCTTCCGTGGTGGCGACAAGCGCGGCGGCGC
CAATGGTGCCCGTATTGCTTTGCAACCCCAGGCTTCGTGGGCGGTGAACAACCCCAAGCAGCTGCAGACCGTGCTATCCGCT
GTATGTCTTTTACTCTCCCATTTGTCCTTTGCTTCTCT
GAGGTTGCTGACTGACCGCCGGATTTAGTTGACCACGATCAAGAACAACTTCAACAAGGGAGGCAGGAAAGTCTCCCTGGCTGATCTCATCGTCCTGGGTGGAAATGCCGCCGTCGAGAA
GGCTGCCGCTGCCGCCGGTTCTAAGATCTCTGTGCCATTCACGGTTGGCCGCGTCGACGCAACCCAGGACAACACAGATATTTCCACCTTCGAGAATCTCAACCCGCAGGGTGACGGCTT
CCGCAACTACCGCAACAGCTCGGGCTGGTCGCTCGCCCGCACCGAGGAGCTCCTTGTCGATAAAGCCCAGCAGCTGACACTGACAGCCCCTGAGATGACTGTGCTCGTTGGCGGCATGCG
CGCCATCAACGCCAACTTTGACGGTTCCTCCAATGGTATCCTGACCAAACGCCCTGGCACGCTCACCAACGACTTCTTCACCAATCTGCTGGACATCAACACCGTGTGGACTCCCGACTC
CACCAATCAGCTGTTCACTGGCAAGGATCGCTCGACCGGTGCGCAGAAGTGGACCGCTACGCGTGCCGATCTCGTCTTCAGCTCACACGCGGAACTGAGGGCGATCTCCGAAGTATACGC
CGAAGCAGGTGGGGCCTCGCAGATGGTAACTGATTTTGTAGCCGCCTGGGCCAAGGTCATGGATTTGGACCGATTTGATGTCAAAAAATATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACCATCAATCCGGACCCTACTGATTGGACTTCTGCCTCTTGTCTCTGCCCAAGGCTGTCCCTATGCCAGCGTGAACAAGCGAGACCTTTTAGTTGCGAGAGGGGACGAGCCGTCC
CTCACAACACTAGCAGACTCTTTCGGCAAATGCCCAACCATCAGCGATGCAGCTGGCGGCGGGACCCGGAGTCGTGACTGGTGGCCATGTCAGTTGCGGCTAGATGTACTGCGTCAATTC
TCGCCGGAGCAGAACCCACTCGGGGGTAGCTTCGACTATACCGCGGCTTTCGCTACGCTGGACA
TTAATGCACTCAAAGCAGACATCATATCGTTGTTGACGGACTCGCAGTCTTGGTGG
CCGGCAGACTTTGGCCATTATGGCGGTCTGTTTATTCGTCTGGCATGGCACAGTGCTGGTACATACCGAGCTGTCGATGGACGTGGTGGTGGTGGCATG
GGCCAACAACGCTTCGCTCCA
CTCAACAGCTGGCCTGATAACGCCAATCTCGACAAAGCACGGCGTCTGCTATGGCCTATCAAGCAGAAGTATGGCAAATCCATCTCGTGGGCCGACTTGCTCCTCTTTACCGGCAACACA
GCCCTTGAACAAATGGGTGTCCCGATCCTTGGTTTTGGTTTCGGTCGTCCCGATACGTGGCAAGCGGATGAGAGCCCTTTCTGGGGCGCAGAGACCACCTTCGTACCCGAAGGAAACGAC
ATCCGCTACAATGGTAGCACTGACTTTGCTGCGCGCGCCAACAAGCTCGAGGAGCCACTTGCCGCCACTCACATGGGTCTAATCTACGTAAACCCCCAGGGCCCCAACGGCAACGGTGAT
CCTAAGACATCGGCCCTTGACATTCGTGAAGCCTTCGGCCGAATGGGGATGAACGACTCTGAGACTGTGGCCCTGATCGCTGGTGGCCACGCATTTGGAAAGACGCATGGCGCGTCTACC
ACTA
CCTTGGGCCCTCCGCCGGAAGGCGGCTCTATTGAGCAGCAGGACTTGGGCTGGGCCAACAGCTTTGGCACTGGCAACGCTGATGATACCATCACCAGTGGATTGGAAGTTATCTGG
TCCAAGACGCCAACGAATTGGACCAATG
GCTTCCTGAACAGTCTTTTCAAGAACACATGGACTCTAGTTAACAGCCCTGCCGGCGCCGTTCAATTCGAGGCATTAAACGGCACTGTTGAC
TACCCTGATCCTTTCAACAAGACATTCCGCCACGCAACTATGCTGGTCAGCGATCTTGCCTTGCGCGAGGATCCTACATTCAGCGCTATTGCCGAGTCCTGGGTGAACAACTTCGAGGCT
CTCACCAATGCCTTTGTGGCTGCATGGT
TCAAACTCCTGCACCGCGATATGGGTCCCATCTCCCGCTACCTCGGCCCGGACGTGCCCAAACAGCAGTTCATCTGGCAGGATCCTCTCCCT
GCTGCGACAGGTTCCCCAATCACCGCCGGCGACCAGGCGAATCTAAAATCGCAAATCCTCGCCGCCCGGGGCATTACCGTCTCGAACTTGGTCTCTGTCGCCTGGGGTTCTGCCTCGACC
TTCCGTGGTGGCGACAAGCGCGGCGGCGCCAATGGTGCCCGTATTGCTTTGCAACCCCAGGCTTCGTGGGCGGTGAACAACCCCAAGCAGCTGCAGACCGTGCTATCCGCT
TTGACCACG
ATCAAGAACAACTTCAACAAGGGAGGCAGGAAAGTCTCCCTGGCTGATCTCATCGTCCTGGGTGGAAATGCCGCCGTCGAGAAGGCTGCCGCTGCCGCCGGTTCTAAGATCTCTGTGCCA
TTCACGGTTGGCCGCGTCGACGCAACCCAGGACAACACAGATATTTCCACCTTCGAGAATCTCAACCCGCAGGGTGACGGCTTCCGCAACTACCGCAACAGCTCGGGCTGGTCGCTCGCC
CGCACCGAGGAGCTCCTTGTCGATAAAGCCCAGCAGCTGACACTGACAGCCCCTGAGATGACTGTGCTCGTTGGCGGCATGCGCGCCATCAACGCCAACTTTGACGGTTCCTCCAATGGT
ATCCTGACCAAACGCCCTGGCACGCTCACCAACGACTTCTTCACCAATCTGCTGGACATCAACACCGTGTGGACTCCCGACTCCACCAATCAGCTGTTCACTGGCAAGGATCGCTCGACC
GGTGCGCAGAAGTGGACCGCTACGCGTGCCGATCTCGTCTTCAGCTCACACGCGGAACTGAGGGCGATCTCCGAAGTATACGCCGAAGCAGGTGGGGCCTCGCAGATGGTAACTGATTTT
GTAGCCGCCTGGGCCAAGGTCATGGATTTGGACCGATTTGATGTCAAAAAATATTAG

Retrieve as FASTA