Entry information : SturCP
Entry ID 10115
Creation 2012-01-06 (Christophe Dunand)
Last sequence changes 2012-01-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: SturCP
Name SturCP
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Setosphaeria
Organism Setosphaeria turcica    [TaxId: 93612 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SturCP
start..stop
S start..stop
ClunCP01 1445 0 1..759 1..760
CheCP_C5 1441 0 1..759 1..761
CheCP_C4 1441 0 1..759 1..761
CheCP10 1441 0 1..759 1..761
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2249057..2249316 260 N° 2 2248504..2248979 476 N° 3 2246910..2248453 1544  
complement(join(2246910..2248453,2248504..2248979,2249057..2249316))


exon

Literature and cross-references SturCP
DNA ref. JGI genome:   scaffold_5 (2249316..2246910)
Cluster/Prediction ref. JGI gene:   164921
Protein sequence: SturCP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   760
PWM (Da):   %s   84135.4  
PI (pH):   %s   6.41
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSKGECPVKVPNVAGAGTRNTDWWPNELRVNILRQHDPRQNPLGPDFNYAEEFKKLDYEGLKKDLTALMTDSQDWWPADFGHYGGLFIRLAWHCAGTYRVTDGRGGGGEGQNRFAPLNAWPDNVSLDKARRLLWPIKQKYGNKISWADLLLLVGNVAIESMGCPTFGFAGGRADTFQSDESVYWGGETEWLGSDVRYADGAKGVKGQGVVDGEQHKVDSKSPHTSRNLEQPLAAAHMGLIYVNPEGPEGVPDPVAAAHDIRTTFGRMAMSDEETAALIVGGHTFGKTHGAAPAENTGPDPNAEDLATQGFGWINKHGRGNGPDTITSGLEVTWTGTPTKWSNKYLEYLYKFEWELEKSPAGANQWVAKTDEHIIPDAYDANKKHKPRMLTTDLSMRMDPAYEKITRRWLEHPEELHDAFVRAWFKLLHRDMGPRSRWLGPEIPKEILLWEDPVPQPEGEIIGDAEIQTLKKQILDAGIEPAKLIRTAWASAASFRGSDKRGGANGARIRLAPQKDWEVNNPKELAEVLKALEGIQSKFNSGSKKVSLADLIVLAGTAAVEKAAGVPVPFAPGRTDATQEQTDVQSFEHLEPVTDGFRNYGKGTERVRTEQLDVDKAHLLRLTAPEMVVLTGGLRALNANWDGSSHGIFTKRPGQLTNDFFLNLLDNNTEWKATDASKEVYEGVDRKSGQKKWTATRHDLVFGHHPELRAIAETYALPESESKFVKDFVAGWEKIMNNDRYDLKNKSVSTSLSGTSKPRL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAAAGGCGAGTGTCCCGTCAAGGTGCCCAATGTCGCTGGTGCCGGCACGAGGAACACAGACTGGTGGCCAAACGAGCTCAGGGTAAACATCCTGCGCCAGCATGACCCCAGACAG
AACCCCCTCGGCCCCGACTTCAACTACGCCGAGGAGTTCAAGAAGCTCGACTATGAGGGCCTCAAGAAGGACCTCACTGCCCTGATGACCGACTCGCAGGACTGGTGGCCTGCCGACTTT
GGCCACTACGGCGGTCTTTT
GTTCGTTTACCCCTCCCCCTCCCCCTCCCCCTCCCCCCGCTTGGCTCCCCCGCCCTTCATGGCTAACGCCTGCACAGCATCCGATTGGCATGGCACTGTG
CTGGCACTTACCGTGTCACTGACGGCCGTGGCGGCGGCGGCGAGGGACAGAACCGATTTGCTCCCCTCAATGCCTGGCCCGACAATGTCTCTCTCGACAAGGCCCGCCGCCTGCTCTGGC
CCATCAAGCAAAAGTACGGCAACAAGATCTCGTGGGCCGACCTGCTGCTTCTCGTCGGCAACGTCGCCATCGAGTCCATGGGCTGCCCCACCTTTGGTTTCGCTGGTGGACGCGCCGACA
CCTTCCAGTCAGACGAGTCTGTCTACTGGGGAGGCGAGACCGAGTGGCTTGGTAGCGACGTCCGCTATGCCGATGGCGCAAAGGGCGTCAAGGGCCAGGGCGTCGTCGATGGCGAGCAGC
ACAAGGTTGACTCGAAGAGCCCCCACACATCGAGGAACCTTGAGCAGCCCTTGGCCGCCGCGCACATGGGTCTCATCTACGTGAACCCAGAGG
GTGAGTGCCTTTTACGCTCTTCCCACA
ATGCCCATCACTAACGCTGTCAGGTCCCGAGGGTGTTCCCGACCCCGTCGCCGCCGCCCACGACATCCGCACAACCTTTGGTCGCATGGCTATGAGCGACGAGGAAACCGCTGCACTCAT
TGTCGGTGGTCACACGTTTGGAAAGACACACGGTGCTGCCCCCGCTGAGAACACCGGCCCAGACCCCAACGCCGAAGACCTGGCAACTCAGGGATTCGGCTGGATCAACAAGCACGGCCG
CGGCAACGGCCCAGACACCATTACCAGTGGTCTCGAGGTGACTTGGACCGGCACACCCACCAAGTGGAGCAACAAGTACCTCGAGTACCTGTACAAGTTTGAGTGGGAGCTGGAGAAGAG
CCCTGCTGGTGCCAACCAATGGGTTGCCAAGACCGACGAGCACATCATTCCCGACGCCTATGACGCCAACAAGAAGCACAAGCCCAGGATGCTTACCACCGACTTGTCGATGCGTATGGA
CCCTGCCTACGAGAAGATTACCCGTCGTTGGCTAGAGCACCCCGAGGAGCTTCACGACGCCTTTGTCCGTGCTTGGTTCAAGCTTCTCCACCGTGACATGGGCCCCCGCTCCAGGTGGCT
CGGCCCCGAGATCCCCAAGGAGATTCTTCTCTGGGAGGACCCTGTCCCTCAACCCGAGGGTGAGATTATCGGCGATGCCGAGATCCAGACTCTGAAGAAGCAGATTCTCGATGCTGGCAT
CGAGCCCGCCAAGCTCATCCGCACTGCCTGGGCTTCCGCTGCCTCTTTCCGTGGTAGCGACAAGCGTGGTGGTGCCAACGGTGCTCGCATTCGTCTTGCTCCTCAGAAGGACTGGGAGGT
CAACAACCCCAAGGAGCTTGCCGAGGTTCTCAAGGCTCTCGAGGGCATTCAGTCCAAGTTCAACAGCGGCAGCAAGAAGGTTTCTCTTGCTGACCTGATTGTCCTTGCCGGTACCGCTGC
CGTTGAGAAGGCTGCTGGTGTACCTGTTCCTTTTGCACCGGGTCGCACCGACGCTACCCAGGAGCAGACCGACGTGCAGTCTTTCGAGCACCTGGAGCCTGTCACAGATGGTTTCCGTAA
CTACGGCAAGGGAACTGAGCGTGTCCGCACCGAGCAACTCGATGTTGACAAGGCCCACCTCCTCCGCCTCACTGCACCCGAGATGGTGGTGCTCACGGGTGGACTGCGTGCGCTCAATGC
CAACTGGGACGGCTCCTCGCACGGAATCTTCACCAAGCGCCCTGGCCAACTCACCAACGACTTCTTCCTCAACCTCCTCGACAACAACACGGAATGGAAGGCAACCGATGCTAGCAAAGA
GGTCTACGAGGGTGTCGACCGCAAGTCTGGCCAGAAGAAGTGGACCGCCACGCGTCACGACCTCGTCTTTGGTCACCACCCTGAGCTCCGTGCCATTGCCGAGACTTATGCTCTGCCCGA
AAGCGAGAGCAAGTTTGTGAAGGACTTTGTTGCCGGCTGGGAGAAGATCATGAACAACGACCGTTACGATCTCAAGAACAAGTCGGTGAGTACATCATTGAGCGGAACAAGCAAGCCCCG
TTTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAAAGGCGAGTGTCCCGTCAAGGTGCCCAATGTCGCTGGTGCCGGCACGAGGAACACAGACTGGTGGCCAAACGAGCTCAGGGTAAACATCCTGCGCCAGCATGACCCCAGACAG
AACCCCCTCGGCCCCGACTTCAACTACGCCGAGGAGTTCAAGAAGCTCGACTATGAGGGCCTCAAGAAGGACCTCACTGCCCTGATGACCGACTCGCAGGACTGGTGGCCTGCCGACTTT
GGCCACTACGGCGGTCTTTT
CATCCGATTGGCATGGCACTGTGCTGGCACTTACCGTGTCACTGACGGCCGTGGCGGCGGCGGCGAGGGACAGAACCGATTTGCTCCCCTCAATGCCTGG
CCCGACAATGTCTCTCTCGACAAGGCCCGCCGCCTGCTCTGGCCCATCAAGCAAAAGTACGGCAACAAGATCTCGTGGGCCGACCTGCTGCTTCTCGTCGGCAACGTCGCCATCGAGTCC
ATGGGCTGCCCCACCTTTGGTTTCGCTGGTGGACGCGCCGACACCTTCCAGTCAGACGAGTCTGTCTACTGGGGAGGCGAGACCGAGTGGCTTGGTAGCGACGTCCGCTATGCCGATGGC
GCAAAGGGCGTCAAGGGCCAGGGCGTCGTCGATGGCGAGCAGCACAAGGTTGACTCGAAGAGCCCCCACACATCGAGGAACCTTGAGCAGCCCTTGGCCGCCGCGCACATGGGTCTCATC
TACGTGAACCCAGAGG
GTCCCGAGGGTGTTCCCGACCCCGTCGCCGCCGCCCACGACATCCGCACAACCTTTGGTCGCATGGCTATGAGCGACGAGGAAACCGCTGCACTCATTGTCGGT
GGTCACACGTTTGGAAAGACACACGGTGCTGCCCCCGCTGAGAACACCGGCCCAGACCCCAACGCCGAAGACCTGGCAACTCAGGGATTCGGCTGGATCAACAAGCACGGCCGCGGCAAC
GGCCCAGACACCATTACCAGTGGTCTCGAGGTGACTTGGACCGGCACACCCACCAAGTGGAGCAACAAGTACCTCGAGTACCTGTACAAGTTTGAGTGGGAGCTGGAGAAGAGCCCTGCT
GGTGCCAACCAATGGGTTGCCAAGACCGACGAGCACATCATTCCCGACGCCTATGACGCCAACAAGAAGCACAAGCCCAGGATGCTTACCACCGACTTGTCGATGCGTATGGACCCTGCC
TACGAGAAGATTACCCGTCGTTGGCTAGAGCACCCCGAGGAGCTTCACGACGCCTTTGTCCGTGCTTGGTTCAAGCTTCTCCACCGTGACATGGGCCCCCGCTCCAGGTGGCTCGGCCCC
GAGATCCCCAAGGAGATTCTTCTCTGGGAGGACCCTGTCCCTCAACCCGAGGGTGAGATTATCGGCGATGCCGAGATCCAGACTCTGAAGAAGCAGATTCTCGATGCTGGCATCGAGCCC
GCCAAGCTCATCCGCACTGCCTGGGCTTCCGCTGCCTCTTTCCGTGGTAGCGACAAGCGTGGTGGTGCCAACGGTGCTCGCATTCGTCTTGCTCCTCAGAAGGACTGGGAGGTCAACAAC
CCCAAGGAGCTTGCCGAGGTTCTCAAGGCTCTCGAGGGCATTCAGTCCAAGTTCAACAGCGGCAGCAAGAAGGTTTCTCTTGCTGACCTGATTGTCCTTGCCGGTACCGCTGCCGTTGAG
AAGGCTGCTGGTGTACCTGTTCCTTTTGCACCGGGTCGCACCGACGCTACCCAGGAGCAGACCGACGTGCAGTCTTTCGAGCACCTGGAGCCTGTCACAGATGGTTTCCGTAACTACGGC
AAGGGAACTGAGCGTGTCCGCACCGAGCAACTCGATGTTGACAAGGCCCACCTCCTCCGCCTCACTGCACCCGAGATGGTGGTGCTCACGGGTGGACTGCGTGCGCTCAATGCCAACTGG
GACGGCTCCTCGCACGGAATCTTCACCAAGCGCCCTGGCCAACTCACCAACGACTTCTTCCTCAACCTCCTCGACAACAACACGGAATGGAAGGCAACCGATGCTAGCAAAGAGGTCTAC
GAGGGTGTCGACCGCAAGTCTGGCCAGAAGAAGTGGACCGCCACGCGTCACGACCTCGTCTTTGGTCACCACCCTGAGCTCCGTGCCATTGCCGAGACTTATGCTCTGCCCGAAAGCGAG
AGCAAGTTTGTGAAGGACTTTGTTGCCGGCTGGGAGAAGATCATGAACAACGACCGTTACGATCTCAAGAACAAGTCGGTGAGTACATCATTGAGCGGAACAAGCAAGCCCCGTTTGTGA

Retrieve as FASTA