Entry information : COsaCP
Entry ID 10117
Creation 2012-01-06 (Christophe Dunand)
Last sequence changes 2012-01-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: COsaCP
Name COsaCP
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus sativus    [TaxId: 45130 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value COsaCP
start..stop
S start..stop
CheCP_C5 1549 0 1..761 1..761
CheCP_C4 1549 0 1..761 1..761
CheCP10 1549 0 1..761 1..761
ClunCP01 1451 0 1..761 1..760
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 111803..112065 263 N° 2 112122..112597 476 N° 3 112650..114196 1547  
join(111803..112065,112122..112597,112650..114196)


exon

Literature and cross-references COsaCP
DNA ref. JGI genome:   scaffold_8 (111803..114196)
Cluster/Prediction ref. JGI gene:   91618
Protein sequence: COsaCP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   762
PWM (Da):   %s   84450.14  
PI (pH):   %s   6.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSKGECPVKKVPNVAGSGTRNSDWWPNELRVNILRQHDPRQNPLGPDFNYAEEFKKLDYDALKKDLTALMTDSQDWWPADFGHYGGFFVRLAWHAAGTYRVTDGRGGGGDGQQRFAPLNAWPDNVSLDKARRLLWPIKQKYGNKISWADLLLLVGNVAIESMGCPTFGFAGGRSDTFQSDESVYWGGETEWLGSDVRYADGAKGIKGEGIMDGDQHKNDAKDTHTSRNLEQPLAAAHMGLIYVNPEGPEGVPDPVAAAHDIRTTFGRMAMNDEETAALIVGGHTFGKTHGAAPSENTGPDPNSEDLGTQGLGWMNKHGRGNGPDTITSGLEVTWTSTPVKWSNKYLEYLYKFEWELEKSPAGANQWVAKTDEEIIPDAYDPNKKHKPRMLTTDLSMRMDPAYEKITRRWLDHPEELHDAFTRAWFKLLHRDMGPRSRWIGPEIPKEILLWEDPVPEPEGEIIGESDIQTLKKQVLDAGIEPAKLIRTAWASAASFRGSDKRGGANGARIRLAPQKDWEVNNPKELAEVLKALEGIQSKFNSGSSKKVSLADLIVLAGTAAVEKAAGVPVPFAPGRSDASQEQTDVQSFEHLEPVTDGFRNYGKGTERVRTEQLDVDKAHLLRLTAPEMVVLTGGMRALNANWDGSSHGIFTQRPGQLTNDFFVNLLDNNLEWKATDASKELYEGFDRKSGQKKWTGTRHDLVFGHHPELRAIAETYASSDNANKFVKDFVAGWEKVMNNDRYDIKNKSVSTPSSGASRPRL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAAAGGCGAGTGTCCTGTCAAGAAGGTGCCCAACGTCGCCGGCTCTGGCACAAGAAACTCGGACTGGTGGCCAAACGAGCTCAGGGTAAACATCCTGCGCCAACATGACCCCAGA
CAGAACCCTCTTGGTCCTGACTTCAACTACGCTGAAGAGTTCAAGAAGCTCGACTACGATGCCTTGAAGAAGGACCTCACTGCCTTGATGACCGACTCCCAGGACTGGTGGCCTGCCGAC
TTTGGTCACTATGGAGGCTTTTT
GTACGTTTAGCCCTTTGCCCTTGCGCCTCTGTCTTGTTATCTAACCCTGCAAATAGCGTCCGTTTGGCATGGCACGCTGCTGGAACATACCGTGTCA
CTGACGGTCGTGGTGGCGGCGGTGATGGACAGCAGCGCTTTGCTCCCCTCAACGCCTGGCCCGACAACGTTTCCCTCGACAAGGCCCGTCGCCTACTCTGGCCCATCAAACAGAAGTACG
GAAACAAGATCTCATGGGCCGATCTCCTGCTTCTCGTCGGAAACGTTGCCATTGAGTCCATGGGATGCCCAACCTTTGGTTTCGCCGGTGGCCGCTCAGACACCTTCCAGTCGGACGAGT
CTGTCTACTGGGGCGGCGAGACCGAGTGGCTCGGCAGCGACGTCCGCTATGCCGACGGCGCAAAGGGTATCAAGGGCGAGGGTATCATGGACGGTGACCAGCACAAGAACGACGCCAAGG
ATACCCACACATCGAGAAACCTTGAGCAGCCACTGGCTGCCGCACACATGGGTCTCATCTATGTGAACCCAGAGG
GTAAGTTTCCTTTTAGAATACACACATCTCTACTCGTTACTGACT
TGTCTAGGTCCCGAGGGCGTACCCGACCCCGTTGCCGCTGCCCACGACATTCGCACAACCTTTGGCCGTATGGCTATGAACGACGAGGAAACCGCTGCTCTCATCGTTGGTGGCCACACA
TTCGGAAAGACACACGGCGCTGCCCCCAGCGAAAACACTGGCCCAGACCCCAACTCGGAAGACCTTGGAACCCAAGGTCTCGGTTGGATGAACAAGCACGGCCGTGGCAACGGTCCAGAT
ACCATCACCAGTGGTCTCGAGGTCACATGGACTAGCACACCCGTCAAGTGGAGCAACAAGTACCTGGAGTACCTTTACAAGTTTGAATGGGAGCTGGAGAAGAGCCCTGCTGGTGCCAAC
CAGTGGGTTGCTAAGACAGATGAGGAGATCATTCCAGACGCTTACGACCCTAACAAAAAGCACAAGCCCAGGATGCTTACCACTGACTTATCGATGCGCATGGACCCTGCCTACGAGAAG
ATCACCCGCCGCTGGCTAGACCACCCTGAGGAACTGCATGACGCTTTTACTCGTGCCTGGTTCAAGCTTCTTCACCGTGACATGGGTCCCCGCTCCAGATGGATCGGCCCAGAGATTCCC
AAGGAAATTCTCCTCTGGGAGGACCCTGTCCCTGAGCCCGAGGGTGAGATCATTGGCGAGTCTGACATCCAAACTTTGAAGAAGCAGGTTCTCGACGCTGGCATTGAGCCTGCCAAGCTT
ATCCGCACTGCTTGGGCTTCCGCAGCTTCTTTCCGCGGTAGCGACAAGCGTGGTGGCGCCAACGGTGCTCGCATCCGCCTCGCTCCCCAAAAGGATTGGGAGGTAAACAACCCTAAGGAG
TTGGCTGAGGTTCTCAAGGCTCTTGAGGGCATTCAGTCTAAGTTCAACAGTGGCAGTAGCAAGAAGGTCTCTCTGGCCGACTTGATTGTCCTTGCTGGTACCGCCGCAGTTGAGAAGGCT
GCCGGTGTGCCTGTTCCCTTTGCGCCGGGCCGCTCCGACGCTTCCCAGGAGCAGACTGATGTGCAGTCTTTCGAGCACCTTGAGCCCGTCACAGATGGTTTCCGCAATTACGGAAAGGGC
ACCGAGCGTGTCCGCACCGAGCAGCTCGATGTTGACAAGGCCCACCTCCTCCGGCTTACTGCCCCCGAGATGGTTGTCCTCACTGGTGGTATGCGTGCGCTGAATGCCAACTGGGACGGC
TCCTCTCACGGAATCTTCACCCAGCGCCCCGGCCAGCTCACCAATGACTTCTTCGTCAACTTGCTCGACAACAACCTTGAATGGAAGGCAACCGACGCCAGCAAGGAGCTATACGAGGGT
TTCGACCGCAAGTCTGGTCAGAAGAAGTGGACGGGCACACGTCACGACCTCGTCTTTGGTCACCACCCTGAGCTCCGTGCCATTGCCGAGACGTACGCATCATCGGACAACGCGAACAAG
TTTGTCAAGGACTTTGTTGCTGGATGGGAGAAGGTTATGAACAACGACCGCTATGATATCAAGAACAAGTCGGTGAGTACACCATCGAGCGGGGCAAGCAGACCTCGTTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAAAGGCGAGTGTCCTGTCAAGAAGGTGCCCAACGTCGCCGGCTCTGGCACAAGAAACTCGGACTGGTGGCCAAACGAGCTCAGGGTAAACATCCTGCGCCAACATGACCCCAGA
CAGAACCCTCTTGGTCCTGACTTCAACTACGCTGAAGAGTTCAAGAAGCTCGACTACGATGCCTTGAAGAAGGACCTCACTGCCTTGATGACCGACTCCCAGGACTGGTGGCCTGCCGAC
TTTGGTCACTATGGAGGCTTTTT
CGTCCGTTTGGCATGGCACGCTGCTGGAACATACCGTGTCACTGACGGTCGTGGTGGCGGCGGTGATGGACAGCAGCGCTTTGCTCCCCTCAACGCC
TGGCCCGACAACGTTTCCCTCGACAAGGCCCGTCGCCTACTCTGGCCCATCAAACAGAAGTACGGAAACAAGATCTCATGGGCCGATCTCCTGCTTCTCGTCGGAAACGTTGCCATTGAG
TCCATGGGATGCCCAACCTTTGGTTTCGCCGGTGGCCGCTCAGACACCTTCCAGTCGGACGAGTCTGTCTACTGGGGCGGCGAGACCGAGTGGCTCGGCAGCGACGTCCGCTATGCCGAC
GGCGCAAAGGGTATCAAGGGCGAGGGTATCATGGACGGTGACCAGCACAAGAACGACGCCAAGGATACCCACACATCGAGAAACCTTGAGCAGCCACTGGCTGCCGCACACATGGGTCTC
ATCTATGTGAACCCAGAGG
GTCCCGAGGGCGTACCCGACCCCGTTGCCGCTGCCCACGACATTCGCACAACCTTTGGCCGTATGGCTATGAACGACGAGGAAACCGCTGCTCTCATCGTT
GGTGGCCACACATTCGGAAAGACACACGGCGCTGCCCCCAGCGAAAACACTGGCCCAGACCCCAACTCGGAAGACCTTGGAACCCAAGGTCTCGGTTGGATGAACAAGCACGGCCGTGGC
AACGGTCCAGATACCATCACCAGTGGTCTCGAGGTCACATGGACTAGCACACCCGTCAAGTGGAGCAACAAGTACCTGGAGTACCTTTACAAGTTTGAATGGGAGCTGGAGAAGAGCCCT
GCTGGTGCCAACCAGTGGGTTGCTAAGACAGATGAGGAGATCATTCCAGACGCTTACGACCCTAACAAAAAGCACAAGCCCAGGATGCTTACCACTGACTTATCGATGCGCATGGACCCT
GCCTACGAGAAGATCACCCGCCGCTGGCTAGACCACCCTGAGGAACTGCATGACGCTTTTACTCGTGCCTGGTTCAAGCTTCTTCACCGTGACATGGGTCCCCGCTCCAGATGGATCGGC
CCAGAGATTCCCAAGGAAATTCTCCTCTGGGAGGACCCTGTCCCTGAGCCCGAGGGTGAGATCATTGGCGAGTCTGACATCCAAACTTTGAAGAAGCAGGTTCTCGACGCTGGCATTGAG
CCTGCCAAGCTTATCCGCACTGCTTGGGCTTCCGCAGCTTCTTTCCGCGGTAGCGACAAGCGTGGTGGCGCCAACGGTGCTCGCATCCGCCTCGCTCCCCAAAAGGATTGGGAGGTAAAC
AACCCTAAGGAGTTGGCTGAGGTTCTCAAGGCTCTTGAGGGCATTCAGTCTAAGTTCAACAGTGGCAGTAGCAAGAAGGTCTCTCTGGCCGACTTGATTGTCCTTGCTGGTACCGCCGCA
GTTGAGAAGGCTGCCGGTGTGCCTGTTCCCTTTGCGCCGGGCCGCTCCGACGCTTCCCAGGAGCAGACTGATGTGCAGTCTTTCGAGCACCTTGAGCCCGTCACAGATGGTTTCCGCAAT
TACGGAAAGGGCACCGAGCGTGTCCGCACCGAGCAGCTCGATGTTGACAAGGCCCACCTCCTCCGGCTTACTGCCCCCGAGATGGTTGTCCTCACTGGTGGTATGCGTGCGCTGAATGCC
AACTGGGACGGCTCCTCTCACGGAATCTTCACCCAGCGCCCCGGCCAGCTCACCAATGACTTCTTCGTCAACTTGCTCGACAACAACCTTGAATGGAAGGCAACCGACGCCAGCAAGGAG
CTATACGAGGGTTTCGACCGCAAGTCTGGTCAGAAGAAGTGGACGGGCACACGTCACGACCTCGTCTTTGGTCACCACCCTGAGCTCCGTGCCATTGCCGAGACGTACGCATCATCGGAC
AACGCGAACAAGTTTGTCAAGGACTTTGTTGCTGGATGGGAGAAGGTTATGAACAACGACCGCTATGATATCAAGAACAAGTCGGTGAGTACACCATCGAGCGGGGCAAGCAGACCTCGT
TTGTAA

Retrieve as FASTA