Entry information : PterCP
Entry ID 10118
Creation 2012-01-06 (Christophe Dunand)
Last sequence changes 2012-01-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PterCP
Name PterCP
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Pyrenophora
Organism Pyrenophora teres    [TaxId: 53485 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PterCP
start..stop
S start..stop
PtritCP01 1554 0 1..760 1..760
AalteCP01 1462 0 1..760 1..760
SturCP 1446 0 1..760 1..759
COsaCP 1441 0 1..760 1..761
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 19776..20038 263 N° 2 20094..20569 476 N° 3 20622..22165 1544  
join(19776..20038,20094..20569,20622..22165)


exon

Literature and cross-references PterCP
DNA ref. JGI genome:   192370 (19776..22165)
Cluster/Prediction ref. JGI gene:   7305
Protein sequence: PterCP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   761
PWM (Da):   %s   84640.18  
PI (pH):   %s   6.41
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSQGECPVKKVPNVAGSGTRNTDWWPNELRTNILRQHDPRQNPLGPDFNYVEEFKKLDYDALKKDLNALMTESQDWWPADFGHYGGLFIRMAWHSAGTYRVTDGRGGGGDGQQRFAPLNAWPDNVSLDKARRLLWPIKQKYGNKISWADLMLLTGNVALESMGCPTFGFAGGRADTFQSDESVYWGGETEWLGSDVRYADGAKGVKGEGIVDGDQHKTDKSEPHTSRNLEQPLAAAHMGLIYVNPEGPEGIPDPVAAAHDIRTTFGRMAMNDEETAALIIGGHSFGKTHGAAPSENTGPDPNSEDLATQGFGWMNKHGRGNGPDTITSGLEVTWTGTPTKWSNKYLEYLYKFEWELEKSPAGANQWVAKTDEHIIPDAYDQNKKHKPRMLTTDLSMRMDPAYEKITRRWLEHPEELHDTFVRAWFKLLHRDMGPRSRWLGPEVPKEVLLWEDPVPQPEGELIGESDIATLKKQVLDAGVEPAKLIRTAWASAASFRGSDKRGGANGARIRLAPQKDWEVNNPKELAEVLKALEGVQSKFNSGSKKVSMADLIVLAGTAAVEKAAGVQVPFTPGRTDATQEQTDVKSFEHLEPVTDGFRNYGKGTDRVRTEQLDVDKAHLLRLTAPEMVVLTGGMRALNANWDGSSHGIFTKRPGQLTNDFFVNLLDNNTEWKATDSSKELYEGFDRKSGQKKWTATRHDLVFGHHPELRAVAETYAQADNTDKFVKDFVAGWEKIMNNDRFDIKNKSVSAQSRGANKPRL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCCAAGGCGAGTGCCCCGTCAAGAAGGTGCCCAACGTCGCCGGCAGTGGTACCAGGAACACCGACTGGTGGCCCAATGAGCTCAGGACAAACATCCTCCGCCAGCACGACCCCAGG
CAGAACCCTCTCGGCCCCGACTTCAACTATGTCGAGGAGTTCAAGAAGCTCGACTACGATGCCTTGAAGAAGGACCTCAATGCCCTGATGACCGAGTCGCAGGACTGGTGGCCCGCCGAC
TTTGGTCATTACGGTGGTCTCTT
GTATGTCTCACACCTGCTTAGCATTGGCTTTGTACCCTATCTGACTCGCGCCCAGCATCCGAATGGCATGGCACTCTGCTGGAACCTACCGTGTTAC
TGACGGCCGAGGCGGCGGTGGTGATGGACAGCAGCGCTTTGCTCCTCTCAACGCCTGGCCCGACAACGTCTCCCTCGACAAGGCTCGCCGCCTCCTCTGGCCCATCAAGCAAAAGTACGG
CAACAAGATCTCCTGGGCCGATCTCATGCTTCTCACCGGCAACGTCGCCCTCGAGTCCATGGGTTGCCCGACATTCGGTTTCGCCGGTGGCCGTGCCGACACCTTCCAGTCCGACGAGTC
GGTCTACTGGGGTGGTGAGACTGAGTGGCTGGGCAGCGATGTCCGCTACGCTGATGGCGCAAAGGGTGTCAAGGGCGAGGGCATCGTGGATGGCGACCAGCACAAGACTGACAAGAGCGA
ACCCCACACATCGAGGAACCTCGAACAGCCATTAGCTGCCGCACACATGGGTCTCATCTACGTGAACCCCGAAG
GTCAGTATTCCTCAGCAGCAAAAGTCCAACCGTCACTAACCCATGC
CTCCAGGTCCCGAAGGTATTCCCGACCCAGTTGCCGCCGCTCACGACATCCGAACAACCTTTGGCCGCATGGCTATGAACGACGAAGAAACCGCTGCCCTCATCATCGGTGGCCACTCGT
TCGGAAAGACGCACGGTGCTGCTCCCTCCGAGAACACCGGCCCAGACCCAAACTCCGAGGATCTCGCAACACAAGGATTTGGCTGGATGAACAAGCACGGTCGCGGCAACGGCCCAGACA
CCATCACCAGTGGACTTGAGGTCACCTGGACCGGCACACCCACCAAGTGGAGCAACAAGTATCTTGAGTACCTCTACAAGTTTGAGTGGGAATTGGAGAAGAGCCCTGCTGGTGCCAACC
AGTGGGTTGCCAAGACCGACGAGCACATTATCCCCGATGCCTACGACCAAAACAAGAAGCATAAGCCAAGGATGTTGACCACTGATTTGTCCATGCGTATGGACCCTGCCTACGAGAAGA
TCACTCGTCGCTGGTTGGAGCACCCCGAGGAGCTCCACGACACTTTCGTTCGTGCATGGTTCAAGCTTCTTCACCGTGATATGGGTCCTCGCTCCAGGTGGCTCGGTCCCGAGGTTCCCA
AGGAGGTCCTTCTCTGGGAAGACCCCGTTCCTCAGCCTGAAGGCGAGCTTATCGGCGAGTCCGACATTGCCACCCTGAAGAAGCAGGTTCTCGATGCTGGCGTTGAGCCCGCTAAGCTTA
TCCGCACTGCTTGGGCTTCGGCAGCTTCGTTCCGTGGCAGCGACAAGCGTGGAGGTGCCAACGGCGCCCGTATCCGCCTCGCTCCCCAAAAGGACTGGGAAGTCAACAACCCCAAGGAGC
TCGCTGAGGTCCTCAAGGCTCTTGAGGGTGTCCAGTCCAAGTTCAACAGCGGCAGCAAGAAGGTTTCCATGGCCGACTTGATCGTACTTGCCGGTACCGCTGCCGTTGAGAAGGCTGCCG
GTGTACAAGTTCCCTTCACACCTGGCCGCACCGACGCCACACAGGAGCAGACCGATGTCAAGTCTTTCGAGCACCTTGAGCCTGTAACCGACGGTTTCCGCAACTACGGCAAGGGAACCG
ACCGTGTCCGTACTGAGCAGCTTGACGTCGACAAGGCCCACCTTCTCCGCCTCACAGCGCCCGAGATGGTTGTCCTCACCGGTGGTATGCGTGCGCTAAACGCCAACTGGGACGGCTCAT
CCCACGGCATCTTTACCAAGCGCCCCGGCCAACTCACCAACGACTTCTTTGTCAACCTCCTTGACAACAACACTGAGTGGAAGGCGACCGACTCCAGCAAGGAGCTGTACGAGGGTTTCG
ACCGCAAGTCGGGCCAAAAGAAGTGGACGGCTACCCGCCACGACCTAGTATTTGGTCACCACCCTGAACTACGTGCGGTTGCCGAGACATACGCTCAGGCCGACAACACGGACAAGTTTG
TCAAGGACTTTGTGGCAGGCTGGGAGAAGATTATGAACAATGACCGGTTCGATATCAAGAACAAGTCGGTGAGTGCACAATCGCGCGGGGCAAACAAGCCTCGTCTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCCAAGGCGAGTGCCCCGTCAAGAAGGTGCCCAACGTCGCCGGCAGTGGTACCAGGAACACCGACTGGTGGCCCAATGAGCTCAGGACAAACATCCTCCGCCAGCACGACCCCAGG
CAGAACCCTCTCGGCCCCGACTTCAACTATGTCGAGGAGTTCAAGAAGCTCGACTACGATGCCTTGAAGAAGGACCTCAATGCCCTGATGACCGAGTCGCAGGACTGGTGGCCCGCCGAC
TTTGGTCATTACGGTGGTCTCTT
CATCCGAATGGCATGGCACTCTGCTGGAACCTACCGTGTTACTGACGGCCGAGGCGGCGGTGGTGATGGACAGCAGCGCTTTGCTCCTCTCAACGCC
TGGCCCGACAACGTCTCCCTCGACAAGGCTCGCCGCCTCCTCTGGCCCATCAAGCAAAAGTACGGCAACAAGATCTCCTGGGCCGATCTCATGCTTCTCACCGGCAACGTCGCCCTCGAG
TCCATGGGTTGCCCGACATTCGGTTTCGCCGGTGGCCGTGCCGACACCTTCCAGTCCGACGAGTCGGTCTACTGGGGTGGTGAGACTGAGTGGCTGGGCAGCGATGTCCGCTACGCTGAT
GGCGCAAAGGGTGTCAAGGGCGAGGGCATCGTGGATGGCGACCAGCACAAGACTGACAAGAGCGAACCCCACACATCGAGGAACCTCGAACAGCCATTAGCTGCCGCACACATGGGTCTC
ATCTACGTGAACCCCGAAG
GTCCCGAAGGTATTCCCGACCCAGTTGCCGCCGCTCACGACATCCGAACAACCTTTGGCCGCATGGCTATGAACGACGAAGAAACCGCTGCCCTCATCATC
GGTGGCCACTCGTTCGGAAAGACGCACGGTGCTGCTCCCTCCGAGAACACCGGCCCAGACCCAAACTCCGAGGATCTCGCAACACAAGGATTTGGCTGGATGAACAAGCACGGTCGCGGC
AACGGCCCAGACACCATCACCAGTGGACTTGAGGTCACCTGGACCGGCACACCCACCAAGTGGAGCAACAAGTATCTTGAGTACCTCTACAAGTTTGAGTGGGAATTGGAGAAGAGCCCT
GCTGGTGCCAACCAGTGGGTTGCCAAGACCGACGAGCACATTATCCCCGATGCCTACGACCAAAACAAGAAGCATAAGCCAAGGATGTTGACCACTGATTTGTCCATGCGTATGGACCCT
GCCTACGAGAAGATCACTCGTCGCTGGTTGGAGCACCCCGAGGAGCTCCACGACACTTTCGTTCGTGCATGGTTCAAGCTTCTTCACCGTGATATGGGTCCTCGCTCCAGGTGGCTCGGT
CCCGAGGTTCCCAAGGAGGTCCTTCTCTGGGAAGACCCCGTTCCTCAGCCTGAAGGCGAGCTTATCGGCGAGTCCGACATTGCCACCCTGAAGAAGCAGGTTCTCGATGCTGGCGTTGAG
CCCGCTAAGCTTATCCGCACTGCTTGGGCTTCGGCAGCTTCGTTCCGTGGCAGCGACAAGCGTGGAGGTGCCAACGGCGCCCGTATCCGCCTCGCTCCCCAAAAGGACTGGGAAGTCAAC
AACCCCAAGGAGCTCGCTGAGGTCCTCAAGGCTCTTGAGGGTGTCCAGTCCAAGTTCAACAGCGGCAGCAAGAAGGTTTCCATGGCCGACTTGATCGTACTTGCCGGTACCGCTGCCGTT
GAGAAGGCTGCCGGTGTACAAGTTCCCTTCACACCTGGCCGCACCGACGCCACACAGGAGCAGACCGATGTCAAGTCTTTCGAGCACCTTGAGCCTGTAACCGACGGTTTCCGCAACTAC
GGCAAGGGAACCGACCGTGTCCGTACTGAGCAGCTTGACGTCGACAAGGCCCACCTTCTCCGCCTCACAGCGCCCGAGATGGTTGTCCTCACCGGTGGTATGCGTGCGCTAAACGCCAAC
TGGGACGGCTCATCCCACGGCATCTTTACCAAGCGCCCCGGCCAACTCACCAACGACTTCTTTGTCAACCTCCTTGACAACAACACTGAGTGGAAGGCGACCGACTCCAGCAAGGAGCTG
TACGAGGGTTTCGACCGCAAGTCGGGCCAAAAGAAGTGGACGGCTACCCGCCACGACCTAGTATTTGGTCACCACCCTGAACTACGTGCGGTTGCCGAGACATACGCTCAGGCCGACAAC
ACGGACAAGTTTGTCAAGGACTTTGTGGCAGGCTGGGAGAAGATTATGAACAATGACCGGTTCGATATCAAGAACAAGTCGGTGAGTGCACAATCGCGCGGGGCAAACAAGCCTCGTCTC
TAG

Retrieve as FASTA