Entry information : FcylCP01 (CAT 1)
Entry ID 10119
Creation 2012-01-06 (Christophe Dunand)
Last sequence changes 2012-01-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-17 (Christophe Dunand)
Peroxidase information: FcylCP01 (CAT 1)
Name (synonym) FcylCP01 (CAT 1)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Bacillariophyta Bacillariophyceae Bacillariaceae Fragilariopsis
Organism Fragilariopsis cylindrus    [TaxId: 186039 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FcylCP01
start..stop
S start..stop
MAspCP01 979 0 8..720 11..737
LnCP01 977 0 8..719 6..725
DdaCP01_Ech586 964 0 8..720 6..733
PstaCP01 959 0 5..725 76..812
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 736206..736219 14 N° 2 735744..735966 223 N° 3 735566..735602 37 N° 4 735206..735439 234
N° 5 733361..735030 1670  
complement(join(733361..735030,735206..735439,735566..735602,735744..735966,7362 06..736219))


exon

Literature and cross-references FcylCP01 (CAT 1)
DNA ref. JGI genome:   scaffold_7 (736219..733361)
EST ref. GenBank:   GW073135.1 [3' end]   GW070752.1 [Fragment]
Cluster/Prediction ref. JGI gene:   261588
Protein sequence: FcylCP01 (CAT 1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   726
PWM (Da):   %s   80152.44  
PI (pH):   %s   5.55
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MADQSVKKCPFLHPGNGTTNSHWWKNNLNIKILNQNNERTDPMPSDFNYATEFGKLDLASLKNDLTTLMTDSQDFWPADYGHYGPFFIRMAWHSAGTYRAHDGRGGAGAGQQRFAPLNSWPDNGNLDKARRLLWPIKQKYGRKISWSDLMVLTGNVALESMGFKTLGFADVWEPEEDVNWGQERTWLDGTKRYSGKRDLDNPLAAVQMGLIYVNPEGPEGNPDPLAAAVDIRETFKRMSMDDTETVALIAGGHTFGKGHGAGDPSSVGSEPEAASIEEQGLGWKNKFGTGKGADTITSGLEGAWTKNPTQWDNGYFDVLFSYEWELTKSPAGAKLWTPTNGEGAGEVPDAHDPNKTHAPIMYTTDMSLRLDPKYAVISKRFHENPEEFREAFAKAWYKLMHRDMGPYARCLGPEVPPPQIWQDPVPPNKTATIDTSDEIELKKKILESGLSPSRLAATAWASASTYRNSDKRGGANGARICLDPQRNWEVNEPAELQKVLAVLKGVQHEFNTKHATKKVSMADLIVLGGCTGVEAAARLTGYDVSVPFTPGRTDASQEMTDVESQKFLKPMADGFRNYIQTGLDVRPEELLVDKAHLLALTAPEMTVLVGGLRVLGIGTNDSSAFTENVGHLSNDFFVNLLDMGTVWSPSKDTKYMYKGCDRATGSSKWTATSGDLIFGSHSVLRALSEVYASDDYREDFVRDFCSVYAKVMNLDRFDVSTNSRL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns) and 8 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGATCAAAGGTACGTAACATGCTTCCTCCGTGCAACAAAGCTTTTCCACAGGTTTCCACGTCATAAAAATTTCGCGATAAATGCTCGGAGATTGAGTGAGTGAGTGTGTATTATT
CCTACAATACTATCCTGGTTACGGGTGAGTCGAGTTGAGTCCTCTTTATAGCCTAACGATACTTACCATCTGTTTGTCCTCGTTATATATATATATATATATATATATTTTGTTTCTTCA
ATTTACATAATAGCGTAAAGAAATGTCCTTTTCTACATCCCGGAAACGGTACAACAAATAGCCATTGGTGGAAGAACAATCTAAACATTAAGATCTTGAACCAAAACAATGAACGTACCG
ACCCTATGCCTTCTGACTTTAACTACGCTACAGAATTTGGAAAGTTAGATCTAGCCAGTTTGAAGAATGATTTGACTACATTGATGACAGATTCTCAAGATTTTTGGCCTGCAGAT
GTAA
GTCAATAATAATAATATCGAACTCTGTTATATCTAAAAGCCTCTGTTTTTCAATGTAATACTAGACTAGTACATATCTCATGGATGTCTGCTTCGTCGTGATACTCACTGTTTCCGTTCG
ACCGTTTGATTATACAGTATGGACATTATGGACCCTTCTTCATTCGGATGGCATGTAAGTCAAATCAAACTGTTACTGTAGAATTGAAAAAAAATGTATAGGTTTCTAATTTAACACTTG
TGATCCTCACTCACTCACTCTTTCTATTATATTATATTCGACCGACGATACAATTTATAGGGCACAGTGCTGGTACTTATCGAGCTCACGATGGACGCGGTGGTGCTGGAGCGGGTCAAC
AGAGATTCGCTCCTCTCAACAGTTGGCCTGATAATGGCAATTTGGATAAAGCACGCCGCTTGTTGTGGCCAATCAAACAAAAGTACGGAAGAAAGATATCCTGGTCTGATTTGATGGTCC
TCACCGGCAACGTTGCGTTAGAATCAATGGGATTCAAAACCCTAGGTTTTGCAG
GTACGTTATTTTCGCCACCGCAGATGCAATATTGATTAACACTGTTGTAAAATTAAAAACCAAATT
AGACCGAGTGTATACCACAGCAAGCAATATTCACTGCAGTACACGTCATTAACACACACATGCACATACACATACACATATATACACACACACACAGGTGGCCGAGAAGATGTATGGGAA
CCTGAAGAAGACGTAAATTGGGGCCAGGAACGTACCTGGCTGGATGGCACCAAACGGTACAGCGGAAAAAGAGACCTAGACAACCCTCTTGCTGCGGTCCAGATGGGATTGATTTATGTG
AATCCAGAAGGACCTGAAGGTAATCCAGATCCTCTTGCTGCCGCAGTTGACATTCGAGAAACGTTTAAAAGAATGTCAATGGACGATACTGAGACAGTAGCCTTAATTGCAGGCGGTCAT
ACTTTTGGAAAAGGGCACGGTGCTGGAGATCCATCATCTGTAGGTTCTGAGCCTGAAGCTGCTTCTATCGAAGAACAAGGACTTGGTTGGAAAAATAAATTCGGAACAGGAAAGGGGGCA
GATACAATTACTTCTGGGTTAGAAGGCGCGTGGACCAAAAACCCAACACAATGGGACAATGGCTACTTTGATGTTCTATTTTCGTACGAGTGGGAGCTGACAAAAAGCCCTGCTGGTGCT
AAGTTATGGACCCCAACGAATGGAGAAGGTGCTGGAGAAGTTCCTGATGCCCATGACCCTAATAAAACACATGCTCCTATTATGTACACAACGGACATGTCTCTTCGCCTCGATCCGAAA
TACGCTGTTATTTCCAAGCGCTTCCATGAAAATCCTGAGGAGTTTAGGGAAGCATTTGCTAAGGCTTGGTACAAGCTAATGCACCGTGATATGGGTCCTTATGCTCGTTGCTTGGGACCT
GAAGTACCTCCACCACAAATCTGGCAGGATCCGGTCCCCCCGAACAAAACGGCGACTATTGATACATCAGACGAGATCGAACTTAAGAAGAAGATTCTTGAGAGTGGTTTGTCTCCTAGT
CGTCTTGCTGCAACTGCATGGGCCTCAGCTTCTACCTACCGCAATTCCGATAAACGTGGAGGAGCTAATGGGGCAAGGATATGTCTTGATCCTCAGAGAAACTGGGAAGTGAACGAACCT
GCAGAATTACAAAAGGTTTTGGCGGTATTGAAAGGAGTTCAGCATGAATTCAATACGAAACATGCAACGAAGAAAGTCTCCATGGCTGATTTGATCGTACTTGGTGGCTGCACTGGAGTA
GAAGCGGCTGCTAGATTGACTGGTTACGACGTGAGTGTTCCCTTCACTCCAGGCCGCACTGACGCATCGCAAGAGATGACTGATGTCGAGTCTCAAAAGTTCTTGAAGCCAATGGCAGAT
GGTTTCCGCAATTACATTCAAACTGGTCTGGACGTTCGTCCCGAAGAATTGCTTGTAGATAAAGCCCACCTTCTTGCTTTGACAGCACCAGAAATGACAGTTCTTGTGGGCGGTTTGCGT
GTTTTGGGTATCGGAACTAATGATTCCAGCGCCTTCACCGAAAACGTTGGACATCTTTCAAACGATTTCTTTGTGAATTTGTTGGACATGGGAACCGTTTGGTCGCCAAGTAAGGACACA
AAGTACATGTACAAAGGCTGTGATCGTGCTACGGGTAGTTCGAAATGGACTGCAACTAGTGGTGATTTGATATTTGGGTCACATTCTGTTTTGCGTGCTCTATCGGAGGTCTATGCAAGT
GACGACTACAGAGAGGATTTTGTACGAGATTTTTGTTCCGTTTACGCTAAAGTTATGAATCTCGATCGGTTTGATGTCAGCACCAACAGTCGCTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGATCAAAGCGTAAAGAAATGTCCTTTTCTACATCCCGGAAACGGTACAACAAATAGCCATTGGTGGAAGAACAATCTAAACATTAAGATCTTGAACCAAAACAATGAACGTACC
GACCCTATGCCTTCTGACTTTAACTACGCTACAGAATTTGGAAAGTTAGATCTAGCCAGTTTGAAGAATGATTTGACTACATTGATGACAGATTCTCAAGATTTTTGGCCTGCAGAT
TAT
GGACATTATGGACCCTTCTTCATTCGGATGGCAT
GGCACAGTGCTGGTACTTATCGAGCTCACGATGGACGCGGTGGTGCTGGAGCGGGTCAACAGAGATTCGCTCCTCTCAACAGTTGG
CCTGATAATGGCAATTTGGATAAAGCACGCCGCTTGTTGTGGCCAATCAAACAAAAGTACGGAAGAAAGATATCCTGGTCTGATTTGATGGTCCTCACCGGCAACGTTGCGTTAGAATCA
ATGGGATTCAAAACCCTAGGTTTTGCAG
ATGTATGGGAACCTGAAGAAGACGTAAATTGGGGCCAGGAACGTACCTGGCTGGATGGCACCAAACGGTACAGCGGAAAAAGAGACCTAGAC
AACCCTCTTGCTGCGGTCCAGATGGGATTGATTTATGTGAATCCAGAAGGACCTGAAGGTAATCCAGATCCTCTTGCTGCCGCAGTTGACATTCGAGAAACGTTTAAAAGAATGTCAATG
GACGATACTGAGACAGTAGCCTTAATTGCAGGCGGTCATACTTTTGGAAAAGGGCACGGTGCTGGAGATCCATCATCTGTAGGTTCTGAGCCTGAAGCTGCTTCTATCGAAGAACAAGGA
CTTGGTTGGAAAAATAAATTCGGAACAGGAAAGGGGGCAGATACAATTACTTCTGGGTTAGAAGGCGCGTGGACCAAAAACCCAACACAATGGGACAATGGCTACTTTGATGTTCTATTT
TCGTACGAGTGGGAGCTGACAAAAAGCCCTGCTGGTGCTAAGTTATGGACCCCAACGAATGGAGAAGGTGCTGGAGAAGTTCCTGATGCCCATGACCCTAATAAAACACATGCTCCTATT
ATGTACACAACGGACATGTCTCTTCGCCTCGATCCGAAATACGCTGTTATTTCCAAGCGCTTCCATGAAAATCCTGAGGAGTTTAGGGAAGCATTTGCTAAGGCTTGGTACAAGCTAATG
CACCGTGATATGGGTCCTTATGCTCGTTGCTTGGGACCTGAAGTACCTCCACCACAAATCTGGCAGGATCCGGTCCCCCCGAACAAAACGGCGACTATTGATACATCAGACGAGATCGAA
CTTAAGAAGAAGATTCTTGAGAGTGGTTTGTCTCCTAGTCGTCTTGCTGCAACTGCATGGGCCTCAGCTTCTACCTACCGCAATTCCGATAAACGTGGAGGAGCTAATGGGGCAAGGATA
TGTCTTGATCCTCAGAGAAACTGGGAAGTGAACGAACCTGCAGAATTACAAAAGGTTTTGGCGGTATTGAAAGGAGTTCAGCATGAATTCAATACGAAACATGCAACGAAGAAAGTCTCC
ATGGCTGATTTGATCGTACTTGGTGGCTGCACTGGAGTAGAAGCGGCTGCTAGATTGACTGGTTACGACGTGAGTGTTCCCTTCACTCCAGGCCGCACTGACGCATCGCAAGAGATGACT
GATGTCGAGTCTCAAAAGTTCTTGAAGCCAATGGCAGATGGTTTCCGCAATTACATTCAAACTGGTCTGGACGTTCGTCCCGAAGAATTGCTTGTAGATAAAGCCCACCTTCTTGCTTTG
ACAGCACCAGAAATGACAGTTCTTGTGGGCGGTTTGCGTGTTTTGGGTATCGGAACTAATGATTCCAGCGCCTTCACCGAAAACGTTGGACATCTTTCAAACGATTTCTTTGTGAATTTG
TTGGACATGGGAACCGTTTGGTCGCCAAGTAAGGACACAAAGTACATGTACAAAGGCTGTGATCGTGCTACGGGTAGTTCGAAATGGACTGCAACTAGTGGTGATTTGATATTTGGGTCA
CATTCTGTTTTGCGTGCTCTATCGGAGGTCTATGCAAGTGACGACTACAGAGAGGATTTTGTACGAGATTTTTGTTCCGTTTACGCTAAAGTTATGAATCTCGATCGGTTTGATGTCAGC
ACCAACAGTCGCTTGTAA

Retrieve as FASTA