Entry information : OsPrx02 (OS01G10850.1)
Entry ID 1012
Creation 2006-07-17 (Filippo Passardi)
Last sequence changes 2006-07-17 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx02 (OS01G10850.1)
Name (synonym) OsPrx02 (OS01G10850.1)
Class Class III peroxidase    [Orthogroup: Prx156]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Leaves
Radicles
Shoots
Inducer Cold stress
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx02
start..stop
S start..stop
SiPrx20 442 8e-158 21..317 27..321
ZmPrx119 437 2e-155 20..317 40..342
ZmPrx106 427 1e-151 21..317 32..323
BdiPrx51 426 2e-151 19..317 28..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5788551..5788745 195 N° 2 5788825..5789016 192 N° 3 5789083..5789655 573  
join(5788551..5788745,5788825..5789016,5789083..5789655)


exon

Literature and cross-references OsPrx02 (OS01G10850.1)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5QNM7
DNA ref. GenBank:   NC_008394.1 (5788551..5789652)
Protein sequence: OsPrx02 (OS01G10850.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (301)
PWM (Da):   %s   33428.84 (31632.8)  
PI (pH):   %s   8.39 (8.39) Peptide Signal:   %s   cut: 19 range:19-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLVARAVALAVVFLAAEAQLSPGYYNATCPGVVSIVRRGMAQAVQKESRMGASILRLFFHDCFVNGCDASILLDDTANFTGEKNAGPNANSVRGYEVIDAIKAQLEASCKATVSCADIITLAARDAVNLLGGPNWTVPLGRRDARTTSQSAANTNLPPPGASLASLLSMFSAKGLDARDLTALSGAHTVGWARCSTFRTHIYNDTGVNATFASQLRTKSCPTTGGDGNLAPLELQAPNTFDNAYFTDLLSRRVLLRSDQELFGSGAGNGTTDAFVRAYAANATTFAADFAAAMVRLGNLSPLTGKNGEVRINCRRVNSS*

Retrieve as FASTA  
Remarks Complete sequence from DNA (chromo 1, introns 1 and 2) and 6 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCGTGGCGCGCGCTGTGGCCTTGGCGGTGGTGTTCCTCGCGGCGGAGGCTCAGCTGTCGCCGGGGTACTACAACGCGACGTGCCCCGGGGTGGTGTCCATCGTGCGCCGCGGCATG
GCGCAGGCAGTGCAGAAGGAGTCGCGCATGGGCGCCTCCATCCTCCGCCTCTTCTTCCACGACTGCTTCGTCAAC
GTAACTACGCGAAATGGATCTCTTGCTCGGCCAATGTACTTCGCC
TTGTTGAGTTTAATGGCCGCGTGCGTGTGTGCAGGGGTGCGACGCCTCCATCTTGCTCGACGACACGGCGAACTTCACCGGGGAGAAGAACGCCGGGCCGAACGCCAACTCGGTGCGCGG
GTACGAGGTCATCGACGCCATCAAGGCGCAGCTCGAGGCCTCCTGCAAGGCCACCGTCTCCTGCGCCGACATCATCACGCTCGCCGCGCGCGACGCCGTCAACCTG
GTCAGTATCTGCCT
CGTGTTTTTCTGCACCCATGTAATGCTGGCATTAATGGCGGGGCGCGTGCAGCTCGGGGGCCCGAACTGGACGGTGCCGCTGGGGCGGCGTGACGCGCGCACGACGAGCCAGAGCGCGGC
GAACACCAACCTGCCGCCGCCCGGCGCGAGCCTCGCGTCGCTCCTGTCGATGTTCAGCGCCAAGGGCCTCGACGCGCGGGACCTCACCGCGCTGTCGGGCGCGCACACCGTCGGGTGGGC
GCGCTGCTCCACCTTCCGCACGCACATCTACAACGACACCGGCGTGAACGCCACCTTCGCCTCGCAGCTGCGCACCAAGTCCTGCCCGACCACCGGCGGCGACGGCAACCTCGCGCCGCT
CGAGCTGCAGGCGCCCAACACCTTCGACAACGCCTACTTCACGGACCTCCTCAGCCGCCGCGTCCTGCTGCGCTCCGACCAGGAGCTCTTCGGCAGCGGCGCCGGCAATGGCACCACGGA
CGCGTTCGTGCGCGCGTACGCCGCCAACGCGACGACGTTCGCGGCGGACTTCGCCGCCGCGATGGTGAGGCTGGGCAACCTGAGCCCGCTCACCGGGAAGAACGGCGAGGTACGGATCAA
CTGCCGGCGAGTGAACTCATCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCGTGGCGCGCGCTGTGGCCTTGGCGGTGGTGTTCCTCGCGGCGGAGGCTCAGCTGTCGCCGGGGTACTACAACGCGACGTGCCCCGGGGTGGTGTCCATCGTGCGCCGCGGCATG
GCGCAGGCAGTGCAGAAGGAGTCGCGCATGGGCGCCTCCATCCTCCGCCTCTTCTTCCACGACTGCTTCGTCAAC
GGGTGCGACGCCTCCATCTTGCTCGACGACACGGCGAACTTCACC
GGGGAGAAGAACGCCGGGCCGAACGCCAACTCGGTGCGCGGGTACGAGGTCATCGACGCCATCAAGGCGCAGCTCGAGGCCTCCTGCAAGGCCACCGTCTCCTGCGCCGACATCATCACG
CTCGCCGCGCGCGACGCCGTCAACCTG
CTCGGGGGCCCGAACTGGACGGTGCCGCTGGGGCGGCGTGACGCGCGCACGACGAGCCAGAGCGCGGCGAACACCAACCTGCCGCCGCCCGGC
GCGAGCCTCGCGTCGCTCCTGTCGATGTTCAGCGCCAAGGGCCTCGACGCGCGGGACCTCACCGCGCTGTCGGGCGCGCACACCGTCGGGTGGGCGCGCTGCTCCACCTTCCGCACGCAC
ATCTACAACGACACCGGCGTGAACGCCACCTTCGCCTCGCAGCTGCGCACCAAGTCCTGCCCGACCACCGGCGGCGACGGCAACCTCGCGCCGCTCGAGCTGCAGGCGCCCAACACCTTC
GACAACGCCTACTTCACGGACCTCCTCAGCCGCCGCGTCCTGCTGCGCTCCGACCAGGAGCTCTTCGGCAGCGGCGCCGGCAATGGCACCACGGACGCGTTCGTGCGCGCGTACGCCGCC
AACGCGACGACGTTCGCGGCGGACTTCGCCGCCGCGATGGTGAGGCTGGGCAACCTGAGCCCGCTCACCGGGAAGAACGGCGAGGTACGGATCAACTGCCGGCGAGTGAACTCATCATGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGTGGT CGTCGTCAAG GGCTATGCTC GTGGCGCGCG CTGTGGCCTT GGCGGTGGTG TTCCTCGCGG CGGAGGCTCA GCTGTCGCCG GGGTACTACA ACGCGACGTG CCCCGGGGTG  GTGTCCATCG TGCGCCGCGG CATGGCGCAG GCAGTGCAGA AGGAGTCGCG CATGGGCGCC TCCATCCTCC GCCTCTTCTT CCACGACTGC TTCGTCAACG GGTGCGACGC CTCCATCTTG  CTCGACGACA CGGCGAACTT CACCGGGGAG AAGAACGCCG GGCCGAACGC CAACTCGGTG CGCGGGTACG AGGTCATCGA CGCCATCAAG GCGCAGCTCG AGGCCTCCTG CAAGGCCACC  GTCTCCTGCG CCGACATCAT CACGCTCGCC GCGCGCGACG CCGTCAACCT GCTCGGGGGC CCGAACTGGA CGGTGCCGCT GGGGCGGCGT GACGCGCGCA CGACGAGCCA GAGCGCGGCG  AACACCAACC TGCCGCCGCC CGGCGCGAGC CTCGCGTCGC TCCTGTCGAT GTTCAGCGCC AAGGGCCTCG ACGCGCGGGA CCTCACCGCG CTGTCGGGCG CGCACACCGT CGGGTGGGCG  CGCTGCTCCA CCTTCCGCAC GCACATCTAC AACGACACCG GCGTGAACGC CACCTTCGCC TCGCAGCTGC GCACCAAGTC CTGCCCGACC ACCGGCGGCG ACGGCAACCT CGCGCCGCTC  GAGCTGCAGG CGCCCAACAC CTTCGACAAC GCCTACTTCA CGGACCTCCT CAGCCGCCGC GTCCTGCTGC GCTCCGACCA GGAGCTCTTC GGCAGCGGCG CCGGCAATGG CACCACGGAC  GCGTTCGTGC GCGCGTACGC CGCCAACGCG ACGACGTTCG CGGCGGACTT CGCCGCCGCG ATGGTGAGGC TGGGCAACCT GAGCCCGCTC ACCGGGAAGA ACGGCGAGGT ACGGATCAAC 
TGCCGGCGAG TGAACTCATC ATGA 

Retrieve as FASTA