Entry information : AacuDyPrx
Entry ID 10124
Creation 2012-01-09 (Christophe Dunand)
Last sequence changes 2012-01-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: AacuDyPrx
Name AacuDyPrx
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus aculeatus    [TaxId: 5053 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AacuDyPrx
start..stop
S start..stop
NfDyPrx02 932 0 7..542 10..544
AclDyPrx02 915 0 7..542 10..544
AcarDyPrx02 870 0 7..542 10..545
AorDyPrx02 862 0 7..541 10..541
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2031569..2031868 300 N° 2 2031948..2032333 386 N° 3 2032400..2032707 308 N° 4 2032769..2033149 381
N° 5 2033209..2033462 254  
join(2031569..2031868,2031948..2032333,2032400..2032707,2032769..2033149,2033209 ..2033462)


exon

Literature and cross-references AacuDyPrx
DNA ref. JGI genome:   scaffold_5 (2031569..2033462)
Cluster/Prediction ref. JGI gene:   42087
Protein sequence: AacuDyPrx
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   543
PWM (Da):   %s   61501.69  
PI (pH):   %s   5.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRAPEKVNTDNIQGSIWPRLPKHFESYLFFKITDKGKFRKHLRTLLDNNEITTGTQCADHLRGVGEFEEASAQARRDVPEPYRVPFTAVNVAFTHLGLLKVERPEVEVEFAKVQQEDPDEYCRDRINEGLFEKGMFDDLVYEGADSPPALHPDFRAPEANLAKEDPLQRWDWRVDGVFIVAAHSAKALRRKIVDVEDAFYVGDANENSMKIAFRRDGQTRPGANRGKEHFGYEDHISQPKIRGLDPAPAPGEPHACPPGYIFLGFEGDPNKKRGPAWAKEGSFLVFRQLDQKVPEFEKFLEEKASQIPGTNYAGPNGPAKLGAHLMGRWKSGAPVAHAYDEDKPELAFNNTFDFRPKKSIKSCPFAAHIRKMRPRSDKKRDVGTEEDGDETALPEPDSDEEEAEGQEEDASVILRRGITFGPELTEEEKRLRKTIEHRGIYFTCYQSLIRDGFNFLMTRWASNASFPEYKTKTFPDGPGMDPFVNQRLRKDHPEGHISLYDGENPDKTVKLNLGISPWVDQRGGEYFFTPSLSALREHFSTA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTGCCCCAGAGAAGGTCAACACTGACAACATTCAGGGGAGCATCTGGCCCCGGCTGCCCAAGCACTTTGAATCCTACTTGTTTTTCAAAATCACCGACAAGGGCAAGTTCCGCAAA
CACCTGCGGACCCTGCTGGACAACAATGAAATCACCACCGGCACGCAATGCGCGGATCACCTCCGTGGAGTGGGAGAGTTCGAAGAGGCTTCCGCGCAAGCCCGACGTGATGTCCCCGAG
CCCTATCGGGTGCCCTTCACCGCGGTGAATGTGGCCTTCACCCATCTGGGTCTGCTGAAG
GTTGGTAATGGCCTCGAACCCCCCCTTTGCTCTCTGTTCTTTCCTTCCGGACTCTAACGC
CCGGCTTTACGTGTTGTAGGTCGAAAGGCCCGAGGTGGAGGTCGAGTTTGCCAAAGTCCAACAGGAAGACCCCGACGAGTATTGCCGGGACCGAATAAATGAGGGTCTTTTCGAAAAGGG
CATGTTCGATGATTTGGTCTACGAGGGCGCCGATAGCCCCCCTGCGCTGCATCCGGACTTTCGGGCCCCGGAGGCTAATCTGGCCAAGGAAGACCCTCTGCAACGGTGGGACTGGCGTGT
CGATGGTGTCTTCATCGTGGCGGCGCACAGTGCCAAGGCTCTCCGCCGGAAGATCGTGGACGTCGAGGATGCCTTCTACGTGGGCGATGCAAACGAGAACAGTATGAAGATCGCCTTTCG
ACGCGATGGTCAAACCCGACCGGGGGCAAACCGGGGCAAGGAACA
GTACGTGTGTTCTAGGGAAACCTCAATTACATGACCATCATAGACTAACGTACCTCCTCGTTGCAGCTTTGGCTA
CGAAGACCACATCTCGCAGCCCAAGATCCGAGGGCTGGATCCGGCCCCTGCCCCGGGCGAGCCTCATGCCTGTCCTCCGGGGTACATCTTCCTTGGGTTTGAGGGGGATCCCAACAAGAA
GCGAGGCCCGGCCTGGGCCAAGGAGGGCAGTTTTCTGGTTTTCCGGCAGTTGGACCAGAAGGTCCCCGAGTTTGAGAAGTTCCTTGAGGAGAAGGCTTCTCAGATCCCGGGCACCAACTA
TGCGGGGCCCAATGGTCCGGCCAAGCTGGGAGCTCACTTGATGGGTCGCTGGAAGAGTG
GTACGAATCCGGCGAATCTCGATTTCTTCTCTCTTTACAAACGCAGACTGATCAAGCATAG

GCGCTCCCGTGGCGCACGCTTACGACGAGGATAAGCCCGAGTTGGCCTTCAACAACACGTTCGACTTCCGACCCAAGAAGAGCATCAAGAGCTGTCCATTCGCAGCGCACATCCGCAAGA
TGCGCCCTCGATCCGATAAGAAACGCGACGTGGGGACCGAAGAAGACGGGGACGAGACCGCACTGCCCGAGCCCGACAGCGATGAAGAAGAGGCCGAGGGACAAGAAGAGGATGCCAGCG
TCATTCTTCGACGAGGCATTACATTTGGTCCGGAACTGACTGAAGAGGAGAAGCGGCTGCGGAAGACCATCGAGCACCGGGGCATTTACTTTACCTGCTATCAGAGCCTGATCCGGGATG
GATTCAATTTCCTTATGACTC
GTACGTTGGTTGATATTAGGGCTAAGATAGAAGAACTACGCAATGCTGACACGAGCCAGGCTGGGCGAGTAACGCCTCCTTCCCCGAGTACAAGACCAA
GACCTTCCCCGATGGGCCGGGCATGGACCCCTTTGTCAACCAGAGGCTTCGCAAGGATCATCCCGAGGGCCACATCAGTCTGTATGATGGAGAAAACCCCGACAAGACGGTGAAATTGAA
TCTGGGCATTAGCCCCTGGGTGGACCAAAGGGGTGGTGAGTATTTCTTTACTCCTTCGCTCAGCGCGTTGAGGGAGCACTTTTCGACGGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTGCCCCAGAGAAGGTCAACACTGACAACATTCAGGGGAGCATCTGGCCCCGGCTGCCCAAGCACTTTGAATCCTACTTGTTTTTCAAAATCACCGACAAGGGCAAGTTCCGCAAA
CACCTGCGGACCCTGCTGGACAACAATGAAATCACCACCGGCACGCAATGCGCGGATCACCTCCGTGGAGTGGGAGAGTTCGAAGAGGCTTCCGCGCAAGCCCGACGTGATGTCCCCGAG
CCCTATCGGGTGCCCTTCACCGCGGTGAATGTGGCCTTCACCCATCTGGGTCTGCTGAAG
GTCGAAAGGCCCGAGGTGGAGGTCGAGTTTGCCAAAGTCCAACAGGAAGACCCCGACGAG
TATTGCCGGGACCGAATAAATGAGGGTCTTTTCGAAAAGGGCATGTTCGATGATTTGGTCTACGAGGGCGCCGATAGCCCCCCTGCGCTGCATCCGGACTTTCGGGCCCCGGAGGCTAAT
CTGGCCAAGGAAGACCCTCTGCAACGGTGGGACTGGCGTGTCGATGGTGTCTTCATCGTGGCGGCGCACAGTGCCAAGGCTCTCCGCCGGAAGATCGTGGACGTCGAGGATGCCTTCTAC
GTGGGCGATGCAAACGAGAACAGTATGAAGATCGCCTTTCGACGCGATGGTCAAACCCGACCGGGGGCAAACCGGGGCAAGGAACA
CTTTGGCTACGAAGACCACATCTCGCAGCCCAAG
ATCCGAGGGCTGGATCCGGCCCCTGCCCCGGGCGAGCCTCATGCCTGTCCTCCGGGGTACATCTTCCTTGGGTTTGAGGGGGATCCCAACAAGAAGCGAGGCCCGGCCTGGGCCAAGGAG
GGCAGTTTTCTGGTTTTCCGGCAGTTGGACCAGAAGGTCCCCGAGTTTGAGAAGTTCCTTGAGGAGAAGGCTTCTCAGATCCCGGGCACCAACTATGCGGGGCCCAATGGTCCGGCCAAG
CTGGGAGCTCACTTGATGGGTCGCTGGAAGAGTG
GCGCTCCCGTGGCGCACGCTTACGACGAGGATAAGCCCGAGTTGGCCTTCAACAACACGTTCGACTTCCGACCCAAGAAGAGCATC
AAGAGCTGTCCATTCGCAGCGCACATCCGCAAGATGCGCCCTCGATCCGATAAGAAACGCGACGTGGGGACCGAAGAAGACGGGGACGAGACCGCACTGCCCGAGCCCGACAGCGATGAA
GAAGAGGCCGAGGGACAAGAAGAGGATGCCAGCGTCATTCTTCGACGAGGCATTACATTTGGTCCGGAACTGACTGAAGAGGAGAAGCGGCTGCGGAAGACCATCGAGCACCGGGGCATT
TACTTTACCTGCTATCAGAGCCTGATCCGGGATGGATTCAATTTCCTTATGACTC
GCTGGGCGAGTAACGCCTCCTTCCCCGAGTACAAGACCAAGACCTTCCCCGATGGGCCGGGCATG
GACCCCTTTGTCAACCAGAGGCTTCGCAAGGATCATCCCGAGGGCCACATCAGTCTGTATGATGGAGAAAACCCCGACAAGACGGTGAAATTGAATCTGGGCATTAGCCCCTGGGTGGAC
CAAAGGGGTGGTGAGTATTTCTTTACTCCTTCGCTCAGCGCGTTGAGGGAGCACTTTTCGACGGCTTGA

Retrieve as FASTA