Entry information : AclDyPrx02
Entry ID 10126
Creation 2012-01-09 (Christophe Dunand)
Last sequence changes 2012-01-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-26 (Christophe Dunand)
Peroxidase information: AclDyPrx02
Name AclDyPrx02
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus clavatus    [TaxId: 5057 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AclDyPrx02
start..stop
S start..stop
AorDyPrx02 1171 0 1..754 1..751
AflDyPrx02 1167 0 1..754 1..762
NfDyPrx02 1022 0 1..545 1..545
AcarDyPrx02 904 0 1..544 1..545
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2664811..2665119 309 N° 2 2664358..2664740 383 N° 3 2664213..2664302 90 N° 4 2663917..2664134 218
N° 5 2663472..2663852 381 N° 6 2662519..2663402 884  
complement(join(2662519..2663402,2663472..2663852,2663917..2664134,2664213..2664 302,2664358..2664740,2664811..2665119)


exon

Literature and cross-references AclDyPrx02
Protein ref. UniProtKB:   A1C8B1
DNA ref. GenBank:   DS027045.1 (2665119..2662519)
Protein sequence: AclDyPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   754
PWM (Da):   %s   85538.68  
PI (pH):   %s   6.36
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPVDKQERVVDTDNIQGSIWPRLPKFAESYLFFKITDKGRFRKHLRDILDNGEITTGTQCENHLRSIGEFEEACAISRRDIPEDDRKPFTAVNIAFTHMGLLKVENPGVEVKFAATLQKDRDAYSTDRINEGLFEKGMFDDLVYEGADSPPALHADFRAPPGNEDKGGLERWEWRVDGVFIVAAHTPKALRKKICDIEDAFSVGDANKASMKIAFRRDGQHRPGANRGKEHFGYEDHISQPKIKGLDDPPAKGEPHACLPGYIFLGHKGDPNMKRGPEWAKEGSFLVFRQLDQKVPEFERFLEQAAPKIPGNNYGGPNGPAKLGAHMMGRWKGAPVAKAVDEDNPSLAFDNKFDFRPKKSIKGCPFAAHIRKMRPRADKKRDVGTEDDGDSTELPEPDSDESEAEGQEEDASVILRRGITFGPELTEQEKREGRTIEERGIYFTCYQSLIRDGFNFLMTRWASNSSFPEYKTKTFPDGPGMDPFVNQRLRFDHPQGHISLYDGNNSEKTVKLDLGISPWVDQKGGEYFFTPSIKALREQFSTAVSDKEEESLSTKHPTVQELHGRIAQLEDTNMRLEKITHERAQEIESLNAQLNESRQAHQKLLEETGKQSRAILGYAGFTRLDILNQLNDADLRRLKHDVEDTLGSLAEDVNWKQWQRIIHDLDSKYGFKLVYGNGGHYEGQHWREWKAIQHSTSHFKYDRTVAFRNRMGQWCNNMKWDAAGGDAAGCALIWLTFVIQLHDVLQVYKPEVC

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns). Strain="ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGTTGACAAGCAAGAGCGAGTGGTTGACACCGACAACATCCAGGGCAGCATCTGGCCTCGTCTCCCCAAGTTTGCGGAATCATACCTCTTCTTCAAGATCACAGACAAAGGGAGG
TTCCGAAAACACCTTAGAGATATTCTCGACAATGGAGAAATCACCACTGGCACTCAATGCGAGAACCACCTGAGGTCAATTGGGGAGTTTGAAGAGGCCTGTGCTATATCCCGACGTGAT
ATTCCCGAAGACGACCGAAAGCCTTTTACAGCGGTGAATATTGCCTTTACCCATATGGGCTTGCTCAAG
GTTCGTTTCCCCTTCTTCGTTGTATATCTTTCTTTCATGGCGTATTTCCAA
CCTTTCAAACATCTCTTAGGTGGAAAATCCGGGCGTTGAAGTGAAATTTGCCGCGACCCTGCAAAAGGATCGAGATGCCTATAGCACCGATAGAATCAACGAGGGTCTATTCGAGAAAGG
AATGTTTGATGATCTTGTTTACGAAGGTGCCGATAGCCCTCCTGCGTTGCATGCCGACTTCAGAGCGCCTCCCGGGAATGAAGATAAAGGCGGACTCGAACGTTGGGAATGGAGAGTGGA
TGGCGTTTTCATTGTCGCGGCGCACACTCCGAAAGCTCTACGTAAGAAGATTTGCGATATAGAGGATGCGTTCAGCGTGGGAGATGCAAACAAGGCCAGCATGAAGATCGCTTTCCGGAG
AGACGGCCAACATCGTCCAGGTGCAAACCGAGGCAAAGAGCA
GTATGATTGTCTCCTATATCATCCTATTGACTTGAGCGCGATACTGATTTTGTAGTTTCGGTTATGAAGATCATATTT
CTCAACCAAAGATCAAAGGTCTGGATGATCCTCCAGCCAAGGGCGAACCTCATGCCTGTCTACCTGG
GTGCGTTTAGACCCCTTTCAATGCGTTTATGCCCTTTCGATGCGTTTATGATA
GAGGTTGCCCGCTGACATGAGCTAGATACATCTTCTTGGGGCACAAAGGTGACCCTAATATGAAACGAGGCCCCGAATGGGCGAAGGAGGGCAGTTTCTTAGTTTTCCGTCAGCTCGACC
AGAAGGTTCCCGAATTCGAAAGGTTCCTAGAGCAGGCGGCGCCGAAAATCCCTGGGAACAACTATGGGGGGCCCAATGGTCCTGCGAAGCTGGGTGCTCATATGATGGGACGATGGAAAA
GCG
GTACGCCTGTGATGTGTAGATCGCAGTATTAACCACCTGCTACCTGGACTAACAAACATCGCAGGAGCTCCTGTCGCCAAAGCCGTTGACGAAGACAACCCTAGCTTAGCCTTTGAC
AATAAATTCGACTTCAGACCCAAGAAGAGCATAAAGGGCTGTCCGTTCGCGGCCCACATCCGCAAAATGCGTCCGAGAGCCGATAAGAAGCGCGATGTTGGGACAGAGGATGACGGTGAC
AGCACTGAGCTTCCGGAGCCAGACAGCGATGAGTCCGAGGCCGAAGGCCAGGAGGAAGATGCTAGTGTCATTCTCCGCCGTGGTATCACCTTTGGCCCTGAACTCACAGAGCAGGAGAAG
AGGGAGGGCAGGACAATTGAAGAACGTGGGATCTACTTTACCTGCTACCAGAGTCTTATTCGGGACGGGTTCAACTTCCTCATGACAC
GTGAGTTACAGATTCGCTCCAATCATCCACTG
TCCTCCCTATAGGCGTTGGTGATGCTAATAGATACAGGCTGGGCGAGCAATTCCTCTTTCCCCGAGTATAAGACCAAGACGTTCCCTGACGGACCTGGTATGGATCCCTTCGTTAATCAG
AGACTCCGTTTCGATCACCCCCAGGGTCACATCAGTCTGTACGACGGAAACAACTCGGAGAAGACGGTCAAACTTGATCTTGGGATTAGTCCATGGGTTGATCAGAAGGGTGGTGAATAC
TTCTTTACTCCTTCTATCAAGGCTCTGAGAGAGCAATTTTCAACTGCTGTTTCGGACAAAGAAGAAGAATCTCTTTCCACAAAACACCCGACTGTGCAAGAGTTACACGGAAGAATCGCC
CAGCTCGAGGACACCAATATGCGGCTGGAAAAAATCACTCACGAGCGTGCCCAGGAGATTGAGTCTTTGAATGCCCAGCTTAATGAGTCCCGGCAAGCGCATCAGAAGCTTTTGGAGGAA
ACCGGCAAGCAATCTCGTGCTATCCTTGGATATGCAGGGTTTACGCGCTTGGACATTCTAAACCAGTTGAACGACGCAGATCTACGACGGTTAAAACATGACGTCGAAGATACTCTGGGC
AGTCTGGCAGAAGATGTGAACTGGAAGCAGTGGCAACGAATTATTCATGATCTGGACTCAAAATACGGATTCAAGTTAGTTTACGGCAATGGAGGCCATTATGAGGGACAACACTGGAGA
GAATGGAAGGCGATCCAGCATTCGACAAGCCACTTTAAGTATGACCGCACTGTGGCATTTCGCAACCGCATGGGCCAGTGGTGCAACAACATGAAGTGGGATGCAGCTGGTGGAGATGCA
GCTGGATGTGCATTGATCTGGCTTACCTTTGTCATACAGCTACATGATGTGTTGCAGGTATACAAGCCAGAGGTGTGTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGTTGACAAGCAAGAGCGAGTGGTTGACACCGACAACATCCAGGGCAGCATCTGGCCTCGTCTCCCCAAGTTTGCGGAATCATACCTCTTCTTCAAGATCACAGACAAAGGGAGG
TTCCGAAAACACCTTAGAGATATTCTCGACAATGGAGAAATCACCACTGGCACTCAATGCGAGAACCACCTGAGGTCAATTGGGGAGTTTGAAGAGGCCTGTGCTATATCCCGACGTGAT
ATTCCCGAAGACGACCGAAAGCCTTTTACAGCGGTGAATATTGCCTTTACCCATATGGGCTTGCTCAAG
GTGGAAAATCCGGGCGTTGAAGTGAAATTTGCCGCGACCCTGCAAAAGGAT
CGAGATGCCTATAGCACCGATAGAATCAACGAGGGTCTATTCGAGAAAGGAATGTTTGATGATCTTGTTTACGAAGGTGCCGATAGCCCTCCTGCGTTGCATGCCGACTTCAGAGCGCCT
CCCGGGAATGAAGATAAAGGCGGACTCGAACGTTGGGAATGGAGAGTGGATGGCGTTTTCATTGTCGCGGCGCACACTCCGAAAGCTCTACGTAAGAAGATTTGCGATATAGAGGATGCG
TTCAGCGTGGGAGATGCAAACAAGGCCAGCATGAAGATCGCTTTCCGGAGAGACGGCCAACATCGTCCAGGTGCAAACCGAGGCAAAGAGCA
TTTCGGTTATGAAGATCATATTTCTCAA
CCAAAGATCAAAGGTCTGGATGATCCTCCAGCCAAGGGCGAACCTCATGCCTGTCTACCTGG
ATACATCTTCTTGGGGCACAAAGGTGACCCTAATATGAAACGAGGCCCCGAATGGGCG
AAGGAGGGCAGTTTCTTAGTTTTCCGTCAGCTCGACCAGAAGGTTCCCGAATTCGAAAGGTTCCTAGAGCAGGCGGCGCCGAAAATCCCTGGGAACAACTATGGGGGGCCCAATGGTCCT
GCGAAGCTGGGTGCTCATATGATGGGACGATGGAAAAGCG
GAGCTCCTGTCGCCAAAGCCGTTGACGAAGACAACCCTAGCTTAGCCTTTGACAATAAATTCGACTTCAGACCCAAGAAG
AGCATAAAGGGCTGTCCGTTCGCGGCCCACATCCGCAAAATGCGTCCGAGAGCCGATAAGAAGCGCGATGTTGGGACAGAGGATGACGGTGACAGCACTGAGCTTCCGGAGCCAGACAGC
GATGAGTCCGAGGCCGAAGGCCAGGAGGAAGATGCTAGTGTCATTCTCCGCCGTGGTATCACCTTTGGCCCTGAACTCACAGAGCAGGAGAAGAGGGAGGGCAGGACAATTGAAGAACGT
GGGATCTACTTTACCTGCTACCAGAGTCTTATTCGGGACGGGTTCAACTTCCTCATGACAC
GCTGGGCGAGCAATTCCTCTTTCCCCGAGTATAAGACCAAGACGTTCCCTGACGGACCT
GGTATGGATCCCTTCGTTAATCAGAGACTCCGTTTCGATCACCCCCAGGGTCACATCAGTCTGTACGACGGAAACAACTCGGAGAAGACGGTCAAACTTGATCTTGGGATTAGTCCATGG
GTTGATCAGAAGGGTGGTGAATACTTCTTTACTCCTTCTATCAAGGCTCTGAGAGAGCAATTTTCAACTGCTGTTTCGGACAAAGAAGAAGAATCTCTTTCCACAAAACACCCGACTGTG
CAAGAGTTACACGGAAGAATCGCCCAGCTCGAGGACACCAATATGCGGCTGGAAAAAATCACTCACGAGCGTGCCCAGGAGATTGAGTCTTTGAATGCCCAGCTTAATGAGTCCCGGCAA
GCGCATCAGAAGCTTTTGGAGGAAACCGGCAAGCAATCTCGTGCTATCCTTGGATATGCAGGGTTTACGCGCTTGGACATTCTAAACCAGTTGAACGACGCAGATCTACGACGGTTAAAA
CATGACGTCGAAGATACTCTGGGCAGTCTGGCAGAAGATGTGAACTGGAAGCAGTGGCAACGAATTATTCATGATCTGGACTCAAAATACGGATTCAAGTTAGTTTACGGCAATGGAGGC
CATTATGAGGGACAACACTGGAGAGAATGGAAGGCGATCCAGCATTCGACAAGCCACTTTAAGTATGACCGCACTGTGGCATTTCGCAACCGCATGGGCCAGTGGTGCAACAACATGAAG
TGGGATGCAGCTGGTGGAGATGCAGCTGGATGTGCATTGATCTGGCTTACCTTTGTCATACAGCTACATGATGTGTTGCAGGTATACAAGCCAGAGGTGTGTTAG

Retrieve as FASTA