Entry information : AorDyPrx02
Entry ID 10127
Creation 2012-01-09 (Christophe Dunand)
Last sequence changes 2012-01-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-09 (Christophe Dunand)
Peroxidase information: AorDyPrx02
Name AorDyPrx02
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus oryzae    [TaxId: 5062 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AorDyPrx02
start..stop
S start..stop
AflDyPrx02 1545 0 1..751 1..762
AclDyPrx02 1149 0 1..751 1..754
NfDyPrx02 910 0 1..541 1..543
AcarDyPrx02 865 0 1..541 1..544
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4..312 309 N° 2 381..763 383 N° 3 815..904 90 N° 4 960..1168 209
N° 5 1234..1617 384 N° 6 1679..2559 881  
join(4..312,381..763,815..904,960..1168,1234..1617,1679..2559)


exon

Literature and cross-references AorDyPrx02
DNA ref. GenBank:   NW_001884679.1 (52054..49496)
Protein sequence: AorDyPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   751
PWM (Da):   %s   85612.51  
PI (pH):   %s   5.37
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPVPKQNRSVDTDNIQGSIWPRLPKYYETYLFFKITDNEKFRQHLRGILDKGVITTGTECEEHLKSVGEFEEACAYSRRHVPEKDRKPFTAVNVAFTHMGLLKVEHPEVEVNFAQALAEDPEEYCRDRINEGLFEKGMFDDLVYEGADSPPALDPDFRAPPGNESKTGLDRWKWRVDGVFIVAAHNAKALRRKIVDLEDAFNVGDADENSMKIAFRRDGKTRPGANRGKEHFGYEDHISQPKIDGLDDPPARGEPQACPPGYIFLGHEGDPERRRGPKWAKEGSFLVFRQLDQKVPEFEGHLKELAEKIPGNYGGNPEKLGAHMMGRWKGAPVAKAIHEDNPDLAFDNTFDFRPKKDIKGCPFAAHIRKMRPRADKKRDFGSEEDDENHKPLPEPGEDEAFDEGQKEDASVILRRGITFGPELTAEEISKGETIEHRGMYFVCYQSLIRDGFNFLMTRWASNSSFPEYKTKTFPDGPGMDPFINQRLRTDHPEGHISLYDGSNPNKTVKLDLGLSPWVDQKGGEYFFTPSIRALREQFSADTVNTEGESEDPEEDPVVKKLQAKIDELEQEQKALLKVTEERVADIENLEAQLKEAQESHQKFVEETRKGTVVGYAGLIHLDFLNKLETGDLRQLKHQVRDALAQLAGDVDWKTWQRTIRELNSKYGFDLLYGNGGHYEGRHWREWKEIQYSTSNSDYDRTVAFRNRMGQWCNNAKWKAEGGDAAGCALMWLTFVIQLHDVLQVYRPDVC

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGTCCCAAAGCAGAACCGATCGGTCGACACGGACAACATCCAAGGGAGCATTTGGCCCCGTCTCCCTAAATACTATGAAACCTACCTCTTCTTCAAGATCACAGATAACGAAAAG
TTCAGACAGCACCTCAGAGGTATCCTCGATAAAGGGGTGATCACCACCGGCACTGAATGTGAGGAACACTTGAAGTCAGTGGGTGAGTTTGAAGAAGCATGCGCGTATTCTCGTCGTCAT
GTTCCTGAGAAGGATCGGAAGCCCTTCACGGCGGTAAACGTCGCATTCACTCACATGGGGTTGCTCAAG
GTTAGTTTAGACGCTCTATAGGCCTGGTGTCATAGCTGTATATTCTAACAC
CGTGGCCATTTTCCCAGGTGGAACATCCTGAGGTCGAAGTGAACTTTGCCCAGGCCCTAGCGGAAGATCCAGAGGAGTATTGTAGAGATCGGATCAACGAGGGTCTGTTTGAGAAAGGGA
TGTTCGATGATCTGGTGTACGAAGGTGCCGATAGCCCTCCCGCTTTGGATCCCGACTTTAGGGCTCCTCCCGGCAATGAATCCAAGACCGGACTTGACCGGTGGAAGTGGCGAGTGGATG
GTGTGTTCATCGTCGCGGCCCATAATGCGAAAGCTCTACGTCGCAAAATCGTGGATCTGGAAGATGCCTTCAATGTTGGTGATGCGGACGAGAACAGTATGAAGATCGCTTTCAGAAGGG
ATGGTAAAACTCGTCCGGGTGCAAACCGTGGCAAAGAGCA
GTATGTTCCCCTCTGTCGTTCCATCGACCCCGAACGATGCTAATTTTGTAGCTTTGGTTACGAAGATCACATCTCCCAGC
CAAAGATTGACGGCTTAGATGACCCCCCGGCCAGGGGCGAACCTCAGGCATGCCCCCCAGG
GTATGTTCGACCTTTCTTATTTATCAATAGTGGCATGGCGACTAACACAGGCTAGTTAC
ATCTTCCTTGGCCATGAGGGCGATCCCGAACGGAGAAGAGGCCCTAAATGGGCTAAGGAGGGTAGTTTCCTTGTTTTCCGTCAGCTTGACCAAAAGGTTCCTGAATTTGAAGGCCACCTT
AAAGAGCTGGCCGAGAAGATACCTGGCAACTACGGCGGAAATCCCGAGAAGCTGGGTGCCCATATGATGGGACGATGGAAGAGCG
GTGCGCCCCTGAACCTGATATTATCTCATTAGTCA
CCGCTGGACGAGAGCTAATCTATGATACAGGAGCCCCCGTCGCCAAAGCCATCCACGAGGATAACCCGGATCTAGCATTTGACAACACTTTCGACTTTAGACCCAAGAAGGACATTAAGG
GCTGTCCGTTTGCGGCGCACATCCGTAAGATGCGGCCCAGAGCCGATAAGAAGCGAGACTTTGGCTCAGAAGAAGATGATGAGAATCATAAGCCCCTTCCAGAGCCGGGCGAGGACGAGG
CTTTTGATGAAGGACAGAAGGAGGACGCCAGTGTCATCCTCCGTCGGGGTATCACCTTCGGTCCTGAACTGACCGCGGAGGAAATTAGCAAGGGGGAGACAATTGAGCACCGTGGCATGT
ACTTTGTGTGCTACCAGAGTCTTATCCGGGATGGCTTCAACTTCCTCATGACCC
GTAAGTCTACCACCTACATTCGAATCACCTTGCCCACCTGCTAAGATGCTAATTAATATAGGCTGG
GCGAGTAACTCCTCCTTCCCTGAGTACAAGACTAAGACCTTCCCCGACGGTCCTGGTATGGACCCCTTCATCAACCAGAGGCTCCGTACCGATCATCCCGAGGGCCACATCAGTTTGTAC
GATGGAAGCAATCCAAACAAGACCGTTAAGCTTGATCTTGGTCTTAGCCCTTGGGTCGATCAGAAAGGTGGCGAATACTTCTTCACACCTTCTATCAGGGCTTTGCGGGAACAGTTTTCA
GCCGACACGGTGAACACAGAAGGTGAATCCGAAGATCCCGAGGAAGACCCGGTGGTGAAGAAGTTACAGGCCAAGATCGATGAGTTGGAGCAGGAACAGAAAGCGCTACTAAAAGTCACC
GAGGAGCGCGTCGCAGATATCGAGAACTTGGAAGCCCAGCTGAAGGAGGCCCAAGAATCGCATCAGAAATTTGTGGAGGAGACTCGTAAGGGGACTGTCGTAGGATATGCGGGGCTTATC
CACTTGGACTTTTTGAACAAGTTGGAGACCGGGGATTTACGACAGTTGAAACACCAGGTCCGAGATGCTCTGGCACAGTTGGCGGGAGATGTGGACTGGAAAACGTGGCAACGAACCATT
CGAGAGCTCAACTCGAAATACGGATTCGACTTGTTGTACGGTAATGGCGGGCATTACGAGGGGCGTCATTGGAGGGAGTGGAAAGAGATCCAGTATTCGACAAGCAATTCCGACTATGAT
CGTACTGTGGCTTTCCGCAACCGAATGGGCCAGTGGTGCAACAACGCCAAGTGGAAGGCTGAAGGTGGCGATGCCGCTGGATGTGCATTGATGTGGTTGACGTTCGTCATCCAGCTGCAC
GATGTGTTACAGGTGTACCGGCCTGACGTTTGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGTCCCAAAGCAGAACCGATCGGTCGACACGGACAACATCCAAGGGAGCATTTGGCCCCGTCTCCCTAAATACTATGAAACCTACCTCTTCTTCAAGATCACAGATAACGAAAAG
TTCAGACAGCACCTCAGAGGTATCCTCGATAAAGGGGTGATCACCACCGGCACTGAATGTGAGGAACACTTGAAGTCAGTGGGTGAGTTTGAAGAAGCATGCGCGTATTCTCGTCGTCAT
GTTCCTGAGAAGGATCGGAAGCCCTTCACGGCGGTAAACGTCGCATTCACTCACATGGGGTTGCTCAAG
GTGGAACATCCTGAGGTCGAAGTGAACTTTGCCCAGGCCCTAGCGGAAGAT
CCAGAGGAGTATTGTAGAGATCGGATCAACGAGGGTCTGTTTGAGAAAGGGATGTTCGATGATCTGGTGTACGAAGGTGCCGATAGCCCTCCCGCTTTGGATCCCGACTTTAGGGCTCCT
CCCGGCAATGAATCCAAGACCGGACTTGACCGGTGGAAGTGGCGAGTGGATGGTGTGTTCATCGTCGCGGCCCATAATGCGAAAGCTCTACGTCGCAAAATCGTGGATCTGGAAGATGCC
TTCAATGTTGGTGATGCGGACGAGAACAGTATGAAGATCGCTTTCAGAAGGGATGGTAAAACTCGTCCGGGTGCAAACCGTGGCAAAGAGCA
CTTTGGTTACGAAGATCACATCTCCCAG
CCAAAGATTGACGGCTTAGATGACCCCCCGGCCAGGGGCGAACCTCAGGCATGCCCCCCAGG
TTACATCTTCCTTGGCCATGAGGGCGATCCCGAACGGAGAAGAGGCCCTAAATGGGCT
AAGGAGGGTAGTTTCCTTGTTTTCCGTCAGCTTGACCAAAAGGTTCCTGAATTTGAAGGCCACCTTAAAGAGCTGGCCGAGAAGATACCTGGCAACTACGGCGGAAATCCCGAGAAGCTG
GGTGCCCATATGATGGGACGATGGAAGAGCG
GAGCCCCCGTCGCCAAAGCCATCCACGAGGATAACCCGGATCTAGCATTTGACAACACTTTCGACTTTAGACCCAAGAAGGACATTAAG
GGCTGTCCGTTTGCGGCGCACATCCGTAAGATGCGGCCCAGAGCCGATAAGAAGCGAGACTTTGGCTCAGAAGAAGATGATGAGAATCATAAGCCCCTTCCAGAGCCGGGCGAGGACGAG
GCTTTTGATGAAGGACAGAAGGAGGACGCCAGTGTCATCCTCCGTCGGGGTATCACCTTCGGTCCTGAACTGACCGCGGAGGAAATTAGCAAGGGGGAGACAATTGAGCACCGTGGCATG
TACTTTGTGTGCTACCAGAGTCTTATCCGGGATGGCTTCAACTTCCTCATGACCC
GCTGGGCGAGTAACTCCTCCTTCCCTGAGTACAAGACTAAGACCTTCCCCGACGGTCCTGGTATG
GACCCCTTCATCAACCAGAGGCTCCGTACCGATCATCCCGAGGGCCACATCAGTTTGTACGATGGAAGCAATCCAAACAAGACCGTTAAGCTTGATCTTGGTCTTAGCCCTTGGGTCGAT
CAGAAAGGTGGCGAATACTTCTTCACACCTTCTATCAGGGCTTTGCGGGAACAGTTTTCAGCCGACACGGTGAACACAGAAGGTGAATCCGAAGATCCCGAGGAAGACCCGGTGGTGAAG
AAGTTACAGGCCAAGATCGATGAGTTGGAGCAGGAACAGAAAGCGCTACTAAAAGTCACCGAGGAGCGCGTCGCAGATATCGAGAACTTGGAAGCCCAGCTGAAGGAGGCCCAAGAATCG
CATCAGAAATTTGTGGAGGAGACTCGTAAGGGGACTGTCGTAGGATATGCGGGGCTTATCCACTTGGACTTTTTGAACAAGTTGGAGACCGGGGATTTACGACAGTTGAAACACCAGGTC
CGAGATGCTCTGGCACAGTTGGCGGGAGATGTGGACTGGAAAACGTGGCAACGAACCATTCGAGAGCTCAACTCGAAATACGGATTCGACTTGTTGTACGGTAATGGCGGGCATTACGAG
GGGCGTCATTGGAGGGAGTGGAAAGAGATCCAGTATTCGACAAGCAATTCCGACTATGATCGTACTGTGGCTTTCCGCAACCGAATGGGCCAGTGGTGCAACAACGCCAAGTGGAAGGCT
GAAGGTGGCGATGCCGCTGGATGTGCATTGATGTGGTTGACGTTCGTCATCCAGCTGCACGATGTGTTACAGGTGTACCGGCCTGACGTTTGCTAA

Retrieve as FASTA