Entry information : AflDyPrx02
Entry ID 10128
Creation 2012-01-09 (Christophe Dunand)
Last sequence changes 2012-01-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-09 (Christophe Dunand)
Peroxidase information: AflDyPrx02
Name AflDyPrx02
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus flavus    [TaxId: 5059 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AflDyPrx02
start..stop
S start..stop
AorDyPrx02 1545 0 1..762 1..751
AclDyPrx02 1145 0 1..762 1..754
NfDyPrx02 907 0 1..552 1..543
AcarDyPrx02 860 0 1..552 1..544
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 61563..61871 309 N° 2 61112..61494 383 N° 3 60971..61060 90 N° 4 60707..60915 209
N° 5 60258..60674 417 N° 6 59316..60196 881  
complement(join(59316..60196,60258..60674,60707..60915,60971..61060,61112..61494 ,61563..61871))


exon

Literature and cross-references AflDyPrx02
Protein ref. UniProtKB:   B8NC39
DNA ref. GenBank:   NW_002477241.1 (61880..59316)
Protein sequence: AflDyPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   762
PWM (Da):   %s   86844.17  
PI (pH):   %s   5.44
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPVPKQNRSVDTDNIQGSIWPRLPKYYETYLFFKITDNEKFRQHLRGILDKGVITTGTECEEHLKSVGEFEEACAYSRRHVPEKDRKPFTAVNVAFTHMGLLKVEHPEVEVNFAQALAEDPDEYCRDRINEGLFEKGMFDDLVYEGADSPPALDPDFRAPPGNESKTGLDRWKWRVDGVFIVAAHNAKALRRKIVDLEDAFNVGDADENSMKIAFRRDGKTRPGANRGKEHFGYEDHISQPKIDGLDDPPARGEPQACPPGYIFLGHEGDPERRRGPKWAKEGSFLVFRQLDQKVPEFERHLKELAEKIPGNYGGNPEKLGAHMMGRWKATAGRELIYGTGAPVAKAIHEDNPDLAFDNTFDFRPKKDIKGCPFAAHIRKMRPRADKKRDFGSEEDDENHKPLPEPGEDEAFDEGQKEDASVILRRGITFGPELTAEEISKGETIEHRGMYFVCYQSLIRDGFNFLMTRWASNSSFPEYKTKTFPDGPGMDPFINQRLRTDHPEGHISLYDGSNPNKTVKLDLGLSPWVDQKGGEYFFTPSIRALREQFSADTVNTEGESEDPEEDPVVKKLQAKIDELEQEQKALLKITEERVADIENLEAQLKEAQESHQKFVEETRKGTVVGYAGLIHLDFLNKLETGDLRQLKHQVRDALAQLAGDVDWKTWQRTIRELNSKYGFDLLYGNGGHYEGRHWREWKEIQYSTSNSDYDRTVAFRNRMGQWCNNAKWKAEGGDAAGCALMWLTFVIQLHDVLQVYRPDVC

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGTCCCAAAGCAGAACCGATCGGTCGACACGGACAACATCCAAGGGAGCATTTGGCCCCGTCTCCCTAAATACTATGAAACCTACCTCTTCTTCAAGATCACAGATAACGAAAAG
TTCAGACAGCACCTCAGAGGTATCCTCGATAAAGGGGTGATCACCACCGGCACTGAATGTGAGGAACACTTGAAGTCAGTGGGTGAGTTTGAAGAAGCATGCGCATATTCTCGTCGTCAT
GTTCCCGAGAAGGATCGGAAGCCCTTCACGGCGGTAAACGTCGCATTCACTCACATGGGGTTGCTCAAG
GTTAGTTTAGACGCTCTATAGGCCTGGTGTCATAGCTGTATATTCTAACAC
CGTGGCCATTTTCCCAGGTGGAACATCCTGAGGTCGAAGTGAACTTTGCCCAGGCCCTAGCGGAAGATCCAGATGAGTATTGTAGAGATCGGATCAACGAGGGTCTGTTTGAGAAGGGGA
TGTTCGATGATCTGGTGTACGAAGGTGCCGATAGCCCTCCCGCTTTGGATCCCGACTTTAGGGCTCCTCCCGGCAATGAATCCAAGACCGGACTTGACCGGTGGAAGTGGCGAGTGGATG
GTGTGTTCATCGTCGCGGCCCATAATGCGAAAGCTCTACGTCGCAAAATCGTGGATCTGGAAGATGCCTTCAATGTTGGTGATGCGGACGAGAACAGTATGAAGATCGCTTTCAGAAGGG
ATGGTAAAACTCGTCCGGGTGCAAACCGTGGCAAAGAGCA
GTATGTTCCCCTCTGTCGTTCCATCGACCCCGAACGATGCTAATTTTGTAGCTTTGGTTACGAAGATCACATCTCCCAGC
CAAAGATTGACGGCTTGGATGACCCCCCGGCCAGGGGCGAACCTCAGGCATGCCCCCCAGG
GTATGTTCGACCTTTCTTATTTATCAATAGTGGCATGGCGACTAACACAGGCTAGTTAC
ATCTTCCTTGGCCATGAGGGCGATCCCGAACGGAGAAGAGGCCCTAAATGGGCTAAGGAGGGTAGTTTCCTTGTTTTCCGTCAGCTTGACCAAAAGGTTCCTGAATTTGAACGCCACCTT
AAAGAGCTGGCCGAGAAGATACCTGGCAACTACGGCGGAAATCCCGAGAAGCTGGGTGCCCATATGATGGGACGATGGAAGAGCG
GTGCGCCCCTGAACCTGATATTATCTCATTAGCCA
CCGCTGGACGAGAGCTAATCTATGGTACAGGAGCCCCCGTCGCCAAAGCCATCCACGAGGATAACCCGGATCTAGCATTTGACAACACTTTCGACTTTAGACCCAAGAAGGACATTAAGG
GCTGTCCGTTTGCGGCGCACATCCGTAAGATGCGGCCCAGAGCCGATAAGAAGCGAGACTTTGGCTCAGAAGAAGATGATGAGAATCATAAGCCCCTTCCAGAGCCGGGAGAGGACGAGG
CTTTTGATGAAGGACAGAAGGAGGACGCCAGTGTCATCCTCCGTCGGGGTATCACCTTCGGTCCTGAACTGACCGCGGAGGAAATTAGCAAGGGGGAGACAATTGAGCACCGTGGCATGT
ACTTTGTGTGCTACCAGAGTCTTATCCGGGATGGCTTCAACTTTCTCATGACCC
GTAAGTCTACCACCTACATTCGAATCACCTTGCCCACCTGCTAAGATGCTAATTAATATAGGCTGG
GCGAGTAACTCCTCCTTCCCTGAGTACAAGACTAAGACCTTCCCCGACGGTCCTGGTATGGACCCCTTCATCAACCAGAGGCTCCGTACCGATCATCCCGAGGGCCACATCAGTTTGTAC
GATGGAAGCAATCCAAACAAGACCGTTAAGCTTGATCTTGGTCTTAGCCCTTGGGTCGATCAGAAAGGTGGCGAATACTTCTTCACACCTTCTATCAGGGCTTTGCGGGAACAGTTTTCA
GCCGACACGGTGAACACAGAAGGTGAATCCGAAGATCCCGAGGAAGACCCGGTGGTGAAGAAGTTACAGGCCAAGATCGATGAGTTGGAGCAGGAACAGAAAGCGCTACTAAAAATCACC
GAGGAGCGCGTCGCAGATATCGAGAACTTGGAAGCCCAGCTGAAGGAGGCCCAAGAATCGCATCAGAAATTTGTGGAGGAGACTCGTAAGGGGACTGTCGTAGGATATGCGGGGCTTATC
CACTTGGACTTTTTGAACAAGTTGGAGACCGGGGATTTACGACAGTTGAAACACCAGGTCCGAGATGCTCTGGCACAGTTGGCGGGAGATGTGGACTGGAAAACGTGGCAACGAACCATT
CGAGAGCTCAACTCGAAATACGGATTCGACTTGTTGTACGGTAATGGCGGGCATTACGAGGGGCGTCATTGGAGGGAGTGGAAAGAGATCCAGTATTCGACAAGCAATTCCGACTATGAT
CGTACTGTGGCTTTCCGCAACCGAATGGGCCAGTGGTGCAACAACGCCAAGTGGAAGGCTGAAGGTGGCGATGCCGCTGGATGTGCATTGATGTGGTTGACGTTCGTCATCCAGCTGCAC
GATGTGTTACAGGTGTACCGGCCTGACGTTTGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGTCCCAAAGCAGAACCGATCGGTCGACACGGACAACATCCAAGGGAGCATTTGGCCCCGTCTCCCTAAATACTATGAAACCTACCTCTTCTTCAAGATCACAGATAACGAAAAG
TTCAGACAGCACCTCAGAGGTATCCTCGATAAAGGGGTGATCACCACCGGCACTGAATGTGAGGAACACTTGAAGTCAGTGGGTGAGTTTGAAGAAGCATGCGCATATTCTCGTCGTCAT
GTTCCCGAGAAGGATCGGAAGCCCTTCACGGCGGTAAACGTCGCATTCACTCACATGGGGTTGCTCAAG
GTGGAACATCCTGAGGTCGAAGTGAACTTTGCCCAGGCCCTAGCGGAAGAT
CCAGATGAGTATTGTAGAGATCGGATCAACGAGGGTCTGTTTGAGAAGGGGATGTTCGATGATCTGGTGTACGAAGGTGCCGATAGCCCTCCCGCTTTGGATCCCGACTTTAGGGCTCCT
CCCGGCAATGAATCCAAGACCGGACTTGACCGGTGGAAGTGGCGAGTGGATGGTGTGTTCATCGTCGCGGCCCATAATGCGAAAGCTCTACGTCGCAAAATCGTGGATCTGGAAGATGCC
TTCAATGTTGGTGATGCGGACGAGAACAGTATGAAGATCGCTTTCAGAAGGGATGGTAAAACTCGTCCGGGTGCAAACCGTGGCAAAGAGCA
CTTTGGTTACGAAGATCACATCTCCCAG
CCAAAGATTGACGGCTTGGATGACCCCCCGGCCAGGGGCGAACCTCAGGCATGCCCCCCAGG
TTACATCTTCCTTGGCCATGAGGGCGATCCCGAACGGAGAAGAGGCCCTAAATGGGCT
AAGGAGGGTAGTTTCCTTGTTTTCCGTCAGCTTGACCAAAAGGTTCCTGAATTTGAACGCCACCTTAAAGAGCTGGCCGAGAAGATACCTGGCAACTACGGCGGAAATCCCGAGAAGCTG
GGTGCCCATATGATGGGACGATGGAAGAGCG
CCACCGCTGGACGAGAGCTAATCTATGGTACAGGAGCCCCCGTCGCCAAAGCCATCCACGAGGATAACCCGGATCTAGCATTTGACAAC
ACTTTCGACTTTAGACCCAAGAAGGACATTAAGGGCTGTCCGTTTGCGGCGCACATCCGTAAGATGCGGCCCAGAGCCGATAAGAAGCGAGACTTTGGCTCAGAAGAAGATGATGAGAAT
CATAAGCCCCTTCCAGAGCCGGGAGAGGACGAGGCTTTTGATGAAGGACAGAAGGAGGACGCCAGTGTCATCCTCCGTCGGGGTATCACCTTCGGTCCTGAACTGACCGCGGAGGAAATT
AGCAAGGGGGAGACAATTGAGCACCGTGGCATGTACTTTGTGTGCTACCAGAGTCTTATCCGGGATGGCTTCAACTTTCTCATGACCC
GCTGGGCGAGTAACTCCTCCTTCCCTGAGTAC
AAGACTAAGACCTTCCCCGACGGTCCTGGTATGGACCCCTTCATCAACCAGAGGCTCCGTACCGATCATCCCGAGGGCCACATCAGTTTGTACGATGGAAGCAATCCAAACAAGACCGTT
AAGCTTGATCTTGGTCTTAGCCCTTGGGTCGATCAGAAAGGTGGCGAATACTTCTTCACACCTTCTATCAGGGCTTTGCGGGAACAGTTTTCAGCCGACACGGTGAACACAGAAGGTGAA
TCCGAAGATCCCGAGGAAGACCCGGTGGTGAAGAAGTTACAGGCCAAGATCGATGAGTTGGAGCAGGAACAGAAAGCGCTACTAAAAATCACCGAGGAGCGCGTCGCAGATATCGAGAAC
TTGGAAGCCCAGCTGAAGGAGGCCCAAGAATCGCATCAGAAATTTGTGGAGGAGACTCGTAAGGGGACTGTCGTAGGATATGCGGGGCTTATCCACTTGGACTTTTTGAACAAGTTGGAG
ACCGGGGATTTACGACAGTTGAAACACCAGGTCCGAGATGCTCTGGCACAGTTGGCGGGAGATGTGGACTGGAAAACGTGGCAACGAACCATTCGAGAGCTCAACTCGAAATACGGATTC
GACTTGTTGTACGGTAATGGCGGGCATTACGAGGGGCGTCATTGGAGGGAGTGGAAAGAGATCCAGTATTCGACAAGCAATTCCGACTATGATCGTACTGTGGCTTTCCGCAACCGAATG
GGCCAGTGGTGCAACAACGCCAAGTGGAAGGCTGAAGGTGGCGATGCCGCTGGATGTGCATTGATGTGGTTGACGTTCGTCATCCAGCTGCACGATGTGTTACAGGTGTACCGGCCTGAC
GTTTGCTAA

Retrieve as FASTA