Entry information : AcarDyPrx02
Entry ID 10130
Creation 2012-01-09 (Christophe Dunand)
Last sequence changes 2012-04-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-24 (Christophe Dunand)
Peroxidase information: AcarDyPrx02
Name AcarDyPrx02
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus carbonarius    [TaxId: 40993 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcarDyPrx02
start..stop
S start..stop
NfDyPrx02 920 0 1..545 1..544
AclDyPrx02 904 0 1..545 1..544
AorDyPrx02 865 0 1..544 1..541
AacuDyPrx 853 0 10..545 7..542
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11273..11581 309 N° 2 11659..12041 383 N° 3 12104..12193 90 N° 4 12247..12468 222
N° 5 12536..12915 380 N° 6 12964..13217 254  
join(11273..11581,11659..12041,12104..12193,12247..12468,12536..12915,12964..132 17)


exon

Literature and cross-references AcarDyPrx02
DNA ref. JGI genome:   scaffold_92 (11273..11584) [5' end]   scaffold_247 (2094..427) [3' end]
Protein sequence: AcarDyPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   546
PWM (Da):   %s   61511.57  
PI (pH):   %s   5.55
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPVDKKDRVVDTDNIQGSIWPRLPKYYESYLFFKITNKERFRKYLRVLVDSGEVTTGSQCEDHLNAVGEFEEACAHSRRDVPESEREAFTAVNVAFTHMGLLKVEDPKIEPKFAEILADDPDAYCKDRINEGLFEKGMFDDLVYEGADSPPALDPDFRAPPGNEKKEGLDRWEWRVDGVFIVAAHTARALRNKIGDVEDIFHVGDANSTSMKIAFRKDGQLRPGADRGKEHFGFEDHISQPKIKGLDDTPAKGEPHACPPGYIFLGHEGDPNKKRGPAWAKEGSFLVFRQLDQKVPEFNTFLKEAAPSIPGSNYSGEDGPEKLGAHLMGRWKSGAAEYPEAIDRDMPELAFSNKFDFRPKKSIKGCPFAAHIRKMRPRADKKRDIGTEDDGDNEPIPDLETNEIVAEGQHEDASVILRRGITFGPELTEDEKTQNKTIEQRGIYFTCYQSLIRDGFNFLMRWASNASFPEYKTKTYPDGPGMDPFIHQRLHSAHPDGHISLYDGVNPDKTVKLNLGVSPWVKQRGGEYFFTPSIKTLREEFSTA

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns). Two short DNA fragments.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGTCGATAAGAAAGACCGGGTGGTCGACACAGACAACATTCAGGGCAGCATCTGGCCCCGTCTGCCCAAATATTATGAATCCTACCTCTTTTTCAAGATCACAAACAAAGAACGA
TTCAGAAAGTACCTCCGAGTCCTGGTTGACAGCGGGGAAGTCACCACTGGTTCTCAATGCGAGGACCACTTGAATGCAGTCGGCGAGTTCGAAGAAGCCTGTGCCCACTCTCGGCGTGAT
GTGCCTGAATCCGAGCGAGAGGCGTTTACAGCTGTGAATGTCGCCTTCACCCACATGGGCTTGCTCAAG
GTTTGCCTCTCCTCTCTCCTTGATTATAGCTATATTGAATTGAAGCATGTT
CTTACCATCTTCTTCCTCTTTTCCAGGTTGAAGACCCCAAGATCGAGCCCAAATTTGCGGAGATCCTAGCAGATGATCCAGACGCTTATTGCAAGGACCGTATCAATGAGGGTCTATTCG
AGAAAGGCATGTTCGATGACCTCGTCTATGAGGGTGCCGATAGTCCTCCCGCGTTGGATCCCGATTTCAGAGCTCCCCCCGGAAACGAAAAGAAGGAAGGACTTGATCGTTGGGAATGGC
GAGTGGACGGTGTGTTTATCGTCGCTGCGCACACCGCTAGAGCTCTGCGCAACAAGATTGGAGACGTCGAGGATATTTTCCATGTCGGTGATGCCAATTCGACCAGTATGAAGATTGCTT
TCAGAAAGGATGGTCAGCTTCGTCCGGGTGCGGACCGTGGCAAGGAGCA
GTATGTTATTCTCTTGCCTTTCTTCGTTGGATCATGGGTGAATGATACTAATTCGAATCTAGCTTCGGATT
CGAGGATCACATCTCTCAGCCAAAGATCAAGGGCTTGGATGATACGCCGGCCAAGGGTGAACCCCATGCCTGTCCTCCCGG
GTTCGTCACCTCTTTCTTTCTTTATCCTTCAGTTGAATT
CTAACCCGAATCAGATACATCTTCCTCGGACACGAAGGTGACCCCAACAAAAAGAGGGGCCCTGCATGGGCCAAGGAGGGCAGTTTCCTTGTCTTCCGTCAGCTCGACCAAAAGGTCCCT
GAATTCAACACTTTCCTCAAGGAAGCAGCACCATCAATCCCGGGTAGCAATTACAGCGGGGAGGATGGTCCTGAAAAACTGGGTGCTCATCTGATGGGACGATGGAAGAGCGGTGC
GTCT
ACAAATGATATTTCACCCACGAGACCAAGACTAATCAAACAACCCAGGCTGCCCGATCACCAGCGCCGAGTACCCCGAGGCCATCGACCGCGACATGCCAGAACTGGCCTTCTCCAACAA
ATTCGACTTCCGACCCAAGAAGAGCATCAAGGGTTGTCCGTTCGCGGCGCACATCCGCAAGATGCGTCCCCGAGCCGACAAGAAGCGGGACATCGGGACAGAAGACGATGGGGACAACGA
GCCCATCCCCGACTTAGAAACTAATGAGATTGTTGCCGAGGGACAGCACGAGGACGCCAGTGTTATTCTGCGTCGTGGAATCACCTTCGGACCCGAACTCACCGAGGATGAGAAGACGCA
GAACAAGACAATCGAGCAGCGGGGTATCTACTTCACCTGCTACCAGAGTTTGATCCGAGATGGATTCAACTTCCTAATGACTC
GTGGGTGCCTTCTACCTCCCAGTATGGCAATGATGCT
AACAGACGCAGGCTGGGCAAGCAACGCCTCCTTCCCCGAATACAAAACCAAGACCTACCCCGATGGTCCCGGGATGGACCCTTTCATTCACCAAAGACTTCATTCCGCCCATCCCGACGG
CCATATCAGTTTGTATGATGGTGTCAATCCGGATAAAACTGTCAAGCTTAATCTTGGTGTGAGTCCGTGGGTCAAGCAAAGAGGTGGTGAATATTTCTTTACTCCATCTATCAAGACTTT
GAGGGAGGAGTTTTCGACTGCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGTCGATAAGAAAGACCGGGTGGTCGACACAGACAACATTCAGGGCAGCATCTGGCCCCGTCTGCCCAAATATTATGAATCCTACCTCTTTTTCAAGATCACAAACAAAGAACGA
TTCAGAAAGTACCTCCGAGTCCTGGTTGACAGCGGGGAAGTCACCACTGGTTCTCAATGCGAGGACCACTTGAATGCAGTCGGCGAGTTCGAAGAAGCCTGTGCCCACTCTCGGCGTGAT
GTGCCTGAATCCGAGCGAGAGGCGTTTACAGCTGTGAATGTCGCCTTCACCCACATGGGCTTGCTCAAG
GTTGAAGACCCCAAGATCGAGCCCAAATTTGCGGAGATCCTAGCAGATGAT
CCAGACGCTTATTGCAAGGACCGTATCAATGAGGGTCTATTCGAGAAAGGCATGTTCGATGACCTCGTCTATGAGGGTGCCGATAGTCCTCCCGCGTTGGATCCCGATTTCAGAGCTCCC
CCCGGAAACGAAAAGAAGGAAGGACTTGATCGTTGGGAATGGCGAGTGGACGGTGTGTTTATCGTCGCTGCGCACACCGCTAGAGCTCTGCGCAACAAGATTGGAGACGTCGAGGATATT
TTCCATGTCGGTGATGCCAATTCGACCAGTATGAAGATTGCTTTCAGAAAGGATGGTCAGCTTCGTCCGGGTGCGGACCGTGGCAAGGAGCA
CTTCGGATTCGAGGATCACATCTCTCAG
CCAAAGATCAAGGGCTTGGATGATACGCCGGCCAAGGGTGAACCCCATGCCTGTCCTCCCGG
ATACATCTTCCTCGGACACGAAGGTGACCCCAACAAAAAGAGGGGCCCTGCATGGGCC
AAGGAGGGCAGTTTCCTTGTCTTCCGTCAGCTCGACCAAAAGGTCCCTGAATTCAACACTTTCCTCAAGGAAGCAGCACCATCAATCCCGGGTAGCAATTACAGCGGGGAGGATGGTCCT
GAAAAACTGGGTGCTCATCTGATGGGACGATGGAAGAGCGGTGC
CGCCGAGTACCCCGAGGCCATCGACCGCGACATGCCAGAACTGGCCTTCTCCAACAAATTCGACTTCCGACCCAAG
AAGAGCATCAAGGGTTGTCCGTTCGCGGCGCACATCCGCAAGATGCGTCCCCGAGCCGACAAGAAGCGGGACATCGGGACAGAAGACGATGGGGACAACGAGCCCATCCCCGACTTAGAA
ACTAATGAGATTGTTGCCGAGGGACAGCACGAGGACGCCAGTGTTATTCTGCGTCGTGGAATCACCTTCGGACCCGAACTCACCGAGGATGAGAAGACGCAGAACAAGACAATCGAGCAG
CGGGGTATCTACTTCACCTGCTACCAGAGTTTGATCCGAGATGGATTCAACTTCCTAATGACTC
GCTGGGCAAGCAACGCCTCCTTCCCCGAATACAAAACCAAGACCTACCCCGATGGT
CCCGGGATGGACCCTTTCATTCACCAAAGACTTCATTCCGCCCATCCCGACGGCCATATCAGTTTGTATGATGGTGTCAATCCGGATAAAACTGTCAAGCTTAATCTTGGTGTGAGTCCG
TGGGTCAAGCAAAGAGGTGGTGAATATTTCTTTACTCCATCTATCAAGACTTTGAGGGAGGAGTTTTCGACTGCTTAG

Retrieve as FASTA