Entry information : StheAPx-CcP01
Entry ID 10137
Creation 2012-01-09 (Marcel Zamocky)
Last sequence changes 2012-01-11 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-04-10 (Christophe Dunand)
Peroxidase information: StheAPx-CcP01
Name StheAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Chaetomiaceae Thielavia
Organism Sporotrichum thermophile (Myceliophthora thermophila)    [TaxId: 573728 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value StheAPx-CcP01
start..stop
S start..stop
CgAPx-CcP02 1599 0 1..1052 1..1051
CtheAPx-CcP01 1346 0 1..1050 1..1023
CtheAPx-CcP01 336 2e-99 592..931 691..1024
CtheAPx-CcP01 288 2e-82 699..1057 574..908
CtheAPx-CcP01 208 2e-55 580..806 793..1027
PanAPx-CcP01 1315 0 20..1053 24..1038
PanAPx-CcP01 299 4e-86 706..1057 585..935
TterAPx-CcP1 1164 0 1..763 1..753
TterAPx-CcP1 174 2e-45 707..891 584..753
TterAPx-CcP1 164 4e-42 839..1010 588..753
TterAPx-CcP1 102 2e-22 962..1050 591..678
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1821270..1821493 224 N° 2 1821634..1822543 910 N° 3 1822595..1822789 195 N° 4 1822848..1823805 958
N° 5 1823874..1824035 162 N° 6 1824141..1824865 725  
join(1821270..1821493,1821634..1822543,1822595..1822789,1822848..1823805,1823874 ..1824035,1824141..1824865)


exon

Literature and cross-references StheAPx-CcP01
Literature Berka R.M., Tsang A., et al. Unpublished since 2011.
Protein ref. GenBank:   AEO56233.1 UniProtKB:   G2Q8I4
DNA ref. JGI genome:   chromosome_2 (1821270..1824865)
EST ref. GenBank:   GT944387.1   GT944386.1 [3' end]
Protein sequence: StheAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1057 (1036)
PWM (Da):   %s   109961.73 (107807.5)  
PI (pH):   %s   4.31 (4.26) Peptide Signal:   %s   cut: 22 range:22-1057
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTKATLLTGLLSLAAQTGRADPTWPAATDHMEEIVFQLQGFKGSLFNDIITPCNNEAAGPGRITASEWLRVGFHDMAPHNRYFGTGGLDGSLQFELNNGENTGPGHRTTLEFLANYLSSRSSLADLIAAGVYASVRSCGGPIVPLRLGRKDAITAGSAGVPQPQNSVVTFRQQFDRMGFTPTEMIQLVACGHTLGAVHSTEFPQIVPANVGQIPFDTTNATFDNRVATEYVSGNTQNPLVVGASIGVGRNSDFKVYNSDQNVTITTLTDPDVFRDTCRVVLQKMIDVVPAGVTLTDPIAPYAVKPVDMQLTLNSGGTTFLLTGHIRVRTTELPASSIKNVVLTWKDRNGGNDCGSSSTCSTTSTLQGVATGFDDTFFFPIEATIPVASGISSFTLVLNLNDGSSRTYDNNGNSYPMSDAVILQKPQSCLLQGPGALTVSALLRNDLSNLPVNLVVSYLTPRNTPDDNPVPALNEATVQMTKGDCVGPYTFYSGSFTIPGGLSYNARISVTAGSNVTAYTDDFNKASDLSGTCGTFTGGATCSDVTPPSTSSVTSSTSTSSSSASVTSTTSGSSSSTASTTASTTASPTPAVKPTVGGYVFVSCWTEGTGVRALSGATFAYDEMTLESCMANCTGFDYWATEYGRECYCGNSLHPSSSEAPVEECNMVCGGDPTEFCGAGNRLELYSTTATRTTSATPTPTGTLAVKPTVGDYTFVGCQTEAATGRALSGKEVYADDSMTLEKCATYCAGFTYFGTEYGRECFCGNSLNAGSVPAPEAECDMVCAGDPFEYCGAGNRLELYRLSSVSSTAGPSSEAATTSTTTGPATSTTIPSRAPTVSPFTHVGCWTEGAGVRALAAKTYASADNMTLENCAAFCTGYRYFGTEYAAECYCGNALAATSSNASLADCSMPCSGDPAQYCGGPNRLELYEDPTVPPAPTAQPTQPATVTATATGAGGSTTWTWHGCMTEATGVRALGKASTASDELTLEACAAFCEGHAFFGAEYGRECYCGDEFAEGAVEAPEQADCSMPCAGDATQLCGDGNRLSVYAKAEPAA

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 5 introns) and 2 ESTs. Strain="ATCC 42464". Peroxidase domain fused to 4 WSC domains (putative carbohydrate binding domain)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACGAAAGCAACTCTCCTTACCGGTCTGCTGTCGCTCGCGGCCCAGACTGGCAGGGCCGATCCGACATGGCCCGCAGCTACCGACCACATGGAGGAGATCGTCTTCCAGCTTCAG
GGGTTCAAAGGGAGCCTGTTCAACGACATCATCACGCCCTGCAACAACGAAGCTGCCGGTCCTGGACGCATCACGGCGAGCGAATGGCTGCGTGTGGGATTCCA
GTATGTGCTGTCTTAT
TCTTTAGGGTTCCATTTTGTGGGGAGATAGGGGAACGAAGGAAGGATGGGCTGCAGTCAGGCGCAGTTACAAGATTTTTTTTTTTTTTTTTTTTTTTTTTGTGAGCGCTAACCCTTTGAG
CCAGTGACATGGCACCGCACAACCGCTACTTTGGCACAGGTGGACTTGACGGCTCGCTGCAATTCGAGCTGAACAATGGCGAGAACACGGGCCCCGGCCACCGCACTACGCTCGAGTTCC
TTGCCAACTACTTGTCTTCCAGGTCAAGCCTCGCCGACCTGATCGCCGCTGGAGTATACGCCTCGGTTCGCTCCTGCGGCGGCCCCATAGTTCCCCTGAGACTGGGCCGCAAAGATGCCA
TCACGGCCGGCAGCGCGGGTGTTCCGCAGCCCCAGAACTCGGTCGTTACTTTCAGGCAGCAGTTTGACCGGATGGGATTCACCCCCACCGAGATGATCCAGCTGGTCGCCTGCGGCCATA
CCCTCGGCGCTGTTCACAGCACCGAGTTTCCTCAGATCGTCCCCGCCAACGTCGGCCAAATTCCCTTCGATACGACCAACGCCACGTTCGACAACAGGGTGGCCACCGAGTACGTGTCCG
GGAACACCCAGAACCCTCTTGTCGTTGGCGCTTCCATTGGTGTCGGCCGTAATTCGGACTTCAAGGTTTACAACTCGGACCAGAACGTGACCATCACCACCCTGACCGATCCTGATGTCT
TCCGCGACACCTGCCGGGTCGTGCTCCAGAAAATGATCGATGTTGTTCCCGCCGGTGTCACCCTTACCGACCCCATCGCGCCGTATGCCGTCAAGCCGGTCGACATGCAGCTGACCCTGA
ACTCGGGCGGCACCACCTTCCTCTTGACAGGACACATTCGAGTCCGGACCACGGAGCTGCCGGCGAGCTCCATCAAGAACGTTGTCCTCACCTGGAAGGACCGGAACGGCGGGAACGACT
GCGGCTCCTCCAGCACTTGCTCCACGACCTCCACGTTGCAGGGCGTCGCTACCGGATTTGACGACACCTTTGGA
GTACGTAGGATGCCCGACTTGGTTTGGCGTGCTTCTTGCTGACCGT
CTTAGTTCTTCCCGATTGAGGCTACCATTCCGGTTGCGTCCGGTATCTCGTCCTTCACTCTCGTCCTGAACCTCAATGACGGTTCGAGCAGGACATACGATAACAATGGCAACTCGTACC
CCATGTCTGATGCCGTTATCCTGCAGAAGCCACAGAGCTGCCTGCTCCAAGGGCCCGGGGCACTCACTGTCTCTGCTCTT
GTTCGTTTTGCTCTCCTCTTGACGGCAAGTTGTGCAGCGA
GTACTGACCAAGATACAGCTCCGCAACGACCTCAGCAACCTCCCAGTTAATCTCGTGGTCTCGTATCTAACTCCTCGCAACACCCCCGACGACAACCCAGTTCCGGCCCTGAACGAAGCT
ACCGTGCAGATGACGAAGGGCGACTGCGTTGGCCCGTACACTTTCTATTCAGGCAGTTTCACCATTCCCGGCGGGCTTAGCTACAATGCCAGGATCAGCGTAACCGCTGGTTCGAATGTC
ACCGCCTACACTGATGACTTCAACAAGGCGAGCGATCTCAGCGGTACTTGCGGCACCTTCACCGGTGGCGCCACCTGTTCCGATGTTACACCACCGAGTACTTCCTCCGTGACATCGTCG
ACTTCCACGTCCTCCAGCTCTGCTAGCGTTACCAGCACCACGTCCGGTTCCAGCAGCTCGACCGCCAGCACGACCGCCAGCACTACCGCCTCCCCGACCCCTGCTGTCAAGCCTACGGTC
GGTGGTTACGTTTTTGTCAGTTGCTGGACCGAAGGAACGGGCGTGCGGGCGCTCAGCGGGGCTACTTTCGCCTACGATGAGATGACACTCGAATCCTGCATGGCCAACTGCACCGGCTTC
GATTACTGGGCCACCGAGTACGGCAGGGAATGCTACTGTGGCAATAGCCTCCATCCCAGCAGCAGTGAGGCCCCGGTTGAGGAGTGCAACATGGTGTGTGGCGGTGATCCGACCGAATTT
TGCGGCGCCGGAAACCGCCTCGAGCTGTATTCGACCACCGCCACCCGTACCACGTCTGCCACTCCCACCCCGACGGGCACGCTGGCTGTCAAGCCGACTGTGGGCGACTACACCTTTGTC
GGATGCCAGACGGAGGCGGCCACCGGCAGAGCTCTTAGCGGGAAGGAGGTATACGCTGACGACTCGATGACGCTTGAGAAGTGTGCGACGTACTGCGCCGGCTTCACTTACTTCGGCACC
GAGTACGGCCGCGAAT
GTGAGTGGTGGCCTTGACCCCCCGAGCGCAACGGCCCGCCCCGGACAGAGTGGCTGACATGTTTGCAGGCTTCTGCGGTAACAGCCTCAACGCCGGCAGCGTTC
CGGCTCCCGAGGCCGAGTGCGACATGGTGTGCGCAGGTGACCCGTTCGAGTACTGCGGCGCCGGAAACCGCCTCGAGCTCTACCGACTCTCGAGCGTATCCTCCACGGCGGGCCCGTCCT
CGGAAG
GTGAGACGACTTGAATTACCTTTGGCTTGAGCATGAAGAGAACGACACATAAGTCCCTCAACGGATTCCTAACCTTCGCTGTTTTCTTGGGGAAAAAAAAAAAAGCCGCCACGA
CCAGCACAACAACAGGCCCCGCCACCTCGACCACGATTCCCTCGCGGGCCCCGACCGTCTCTCCCTTCACCCACGTCGGCTGCTGGACCGAAGGCGCTGGCGTCCGCGCCCTCGCTGCCA
AGACGTACGCTTCGGCCGACAACATGACCCTCGAGAACTGCGCCGCCTTTTGCACCGGCTACAGGTACTTTGGCACCGAGTACGCCGCCGAGTGTTACTGCGGCAATGCCCTCGCCGCGA
CGTCCTCCAACGCCTCGCTCGCCGACTGCTCCATGCCCTGCTCGGGCGACCCGGCCCAGTACTGCGGCGGGCCCAACCGTCTGGAGCTGTACGAAGACCCTACCGTCCCGCCGGCGCCCA
CGGCACAGCCGACCCAACCCGCCACCGTCACGGCCACCGCGACCGGCGCGGGCGGCAGCACCACATGGACGTGGCACGGGTGCATGACGGAGGCGACGGGCGTGCGGGCGCTCGGGAAGG
CTAGCACCGCGTCGGACGAGCTGACGCTGGAGGCGTGCGCGGCCTTTTGCGAGGGCCACGCTTTCTTCGGGGCCGAGTACGGGCGGGAGTGCTACTGTGGCGATGAGTTCGCCGAGGGTG
CCGTCGAGGCGCCCGAGCAGGCGGACTGCTCGATGCCGTGCGCCGGAGACGCGACCCAGCTGTGCGGCGACGGCAACCGGCTGAGCGTGTACGCCAAGGCGGAGCCGGCAGCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACGAAAGCAACTCTCCTTACCGGTCTGCTGTCGCTCGCGGCCCAGACTGGCAGGGCCGATCCGACATGGCCCGCAGCTACCGACCACATGGAGGAGATCGTCTTCCAGCTTCAG
GGGTTCAAAGGGAGCCTGTTCAACGACATCATCACGCCCTGCAACAACGAAGCTGCCGGTCCTGGACGCATCACGGCGAGCGAATGGCTGCGTGTGGGATTCCA
TGACATGGCACCGCAC
AACCGCTACTTTGGCACAGGTGGACTTGACGGCTCGCTGCAATTCGAGCTGAACAATGGCGAGAACACGGGCCCCGGCCACCGCACTACGCTCGAGTTCCTTGCCAACTACTTGTCTTCC
AGGTCAAGCCTCGCCGACCTGATCGCCGCTGGAGTATACGCCTCGGTTCGCTCCTGCGGCGGCCCCATAGTTCCCCTGAGACTGGGCCGCAAAGATGCCATCACGGCCGGCAGCGCGGGT
GTTCCGCAGCCCCAGAACTCGGTCGTTACTTTCAGGCAGCAGTTTGACCGGATGGGATTCACCCCCACCGAGATGATCCAGCTGGTCGCCTGCGGCCATACCCTCGGCGCTGTTCACAGC
ACCGAGTTTCCTCAGATCGTCCCCGCCAACGTCGGCCAAATTCCCTTCGATACGACCAACGCCACGTTCGACAACAGGGTGGCCACCGAGTACGTGTCCGGGAACACCCAGAACCCTCTT
GTCGTTGGCGCTTCCATTGGTGTCGGCCGTAATTCGGACTTCAAGGTTTACAACTCGGACCAGAACGTGACCATCACCACCCTGACCGATCCTGATGTCTTCCGCGACACCTGCCGGGTC
GTGCTCCAGAAAATGATCGATGTTGTTCCCGCCGGTGTCACCCTTACCGACCCCATCGCGCCGTATGCCGTCAAGCCGGTCGACATGCAGCTGACCCTGAACTCGGGCGGCACCACCTTC
CTCTTGACAGGACACATTCGAGTCCGGACCACGGAGCTGCCGGCGAGCTCCATCAAGAACGTTGTCCTCACCTGGAAGGACCGGAACGGCGGGAACGACTGCGGCTCCTCCAGCACTTGC
TCCACGACCTCCACGTTGCAGGGCGTCGCTACCGGATTTGACGACACCTTTGGA
TTCTTCCCGATTGAGGCTACCATTCCGGTTGCGTCCGGTATCTCGTCCTTCACTCTCGTCCTGAAC
CTCAATGACGGTTCGAGCAGGACATACGATAACAATGGCAACTCGTACCCCATGTCTGATGCCGTTATCCTGCAGAAGCCACAGAGCTGCCTGCTCCAAGGGCCCGGGGCACTCACTGTC
TCTGCTCTT
CTCCGCAACGACCTCAGCAACCTCCCAGTTAATCTCGTGGTCTCGTATCTAACTCCTCGCAACACCCCCGACGACAACCCAGTTCCGGCCCTGAACGAAGCTACCGTGCAG
ATGACGAAGGGCGACTGCGTTGGCCCGTACACTTTCTATTCAGGCAGTTTCACCATTCCCGGCGGGCTTAGCTACAATGCCAGGATCAGCGTAACCGCTGGTTCGAATGTCACCGCCTAC
ACTGATGACTTCAACAAGGCGAGCGATCTCAGCGGTACTTGCGGCACCTTCACCGGTGGCGCCACCTGTTCCGATGTTACACCACCGAGTACTTCCTCCGTGACATCGTCGACTTCCACG
TCCTCCAGCTCTGCTAGCGTTACCAGCACCACGTCCGGTTCCAGCAGCTCGACCGCCAGCACGACCGCCAGCACTACCGCCTCCCCGACCCCTGCTGTCAAGCCTACGGTCGGTGGTTAC
GTTTTTGTCAGTTGCTGGACCGAAGGAACGGGCGTGCGGGCGCTCAGCGGGGCTACTTTCGCCTACGATGAGATGACACTCGAATCCTGCATGGCCAACTGCACCGGCTTCGATTACTGG
GCCACCGAGTACGGCAGGGAATGCTACTGTGGCAATAGCCTCCATCCCAGCAGCAGTGAGGCCCCGGTTGAGGAGTGCAACATGGTGTGTGGCGGTGATCCGACCGAATTTTGCGGCGCC
GGAAACCGCCTCGAGCTGTATTCGACCACCGCCACCCGTACCACGTCTGCCACTCCCACCCCGACGGGCACGCTGGCTGTCAAGCCGACTGTGGGCGACTACACCTTTGTCGGATGCCAG
ACGGAGGCGGCCACCGGCAGAGCTCTTAGCGGGAAGGAGGTATACGCTGACGACTCGATGACGCTTGAGAAGTGTGCGACGTACTGCGCCGGCTTCACTTACTTCGGCACCGAGTACGGC
CGCGAAT
GCTTCTGCGGTAACAGCCTCAACGCCGGCAGCGTTCCGGCTCCCGAGGCCGAGTGCGACATGGTGTGCGCAGGTGACCCGTTCGAGTACTGCGGCGCCGGAAACCGCCTCGAG
CTCTACCGACTCTCGAGCGTATCCTCCACGGCGGGCCCGTCCTCGGAAG
CCGCCACGACCAGCACAACAACAGGCCCCGCCACCTCGACCACGATTCCCTCGCGGGCCCCGACCGTCTCT
CCCTTCACCCACGTCGGCTGCTGGACCGAAGGCGCTGGCGTCCGCGCCCTCGCTGCCAAGACGTACGCTTCGGCCGACAACATGACCCTCGAGAACTGCGCCGCCTTTTGCACCGGCTAC
AGGTACTTTGGCACCGAGTACGCCGCCGAGTGTTACTGCGGCAATGCCCTCGCCGCGACGTCCTCCAACGCCTCGCTCGCCGACTGCTCCATGCCCTGCTCGGGCGACCCGGCCCAGTAC
TGCGGCGGGCCCAACCGTCTGGAGCTGTACGAAGACCCTACCGTCCCGCCGGCGCCCACGGCACAGCCGACCCAACCCGCCACCGTCACGGCCACCGCGACCGGCGCGGGCGGCAGCACC
ACATGGACGTGGCACGGGTGCATGACGGAGGCGACGGGCGTGCGGGCGCTCGGGAAGGCTAGCACCGCGTCGGACGAGCTGACGCTGGAGGCGTGCGCGGCCTTTTGCGAGGGCCACGCT
TTCTTCGGGGCCGAGTACGGGCGGGAGTGCTACTGTGGCGATGAGTTCGCCGAGGGTGCCGTCGAGGCGCCCGAGCAGGCGGACTGCTCGATGCCGTGCGCCGGAGACGCGACCCAGCTG
TGCGGCGACGGCAACCGGCTGAGCGTGTACGCCAAGGCGGAGCCGGCAGCGTGA

Retrieve as FASTA