Entry information : Egr1CysPrx03 (Eucgr.G02036 / Egrandis_v1_0.048784m)
Entry ID 10150
Creation 2012-01-24 (Christophe Dunand)
Last sequence changes 2012-01-24 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: Egr1CysPrx03 (Eucgr.G02036 / Egrandis_v1_0.048784m)
Name (synonym) Egr1CysPrx03 (Eucgr.G02036 / Egrandis_v1_0.048784m)
Class 1-Cysteine peroxiredoxin    [Orthogroup: 1CysPrx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Egr1CysPrx03
start..stop
S start..stop
Egu1CysPrx03 458 2e-167 1..220 1..220
Ecam1CysPrx03-2 453 2e-165 1..220 1..220
Ecam1CysPrx03-1 452 7e-165 1..217 1..217
Egl1CysPrx03-1 414 3e-150 19..216 1..198
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37347001..37347118 118 N° 2 37346739..37346887 149 N° 3 37346092..37346238 147 N° 4 37345714..37345962 249
complement(join(37345714..37345962,37346092..37346238,37346739..37346887,3734700 1..37347118))


exon

Literature and cross-references Egr1CysPrx03 (Eucgr.G02036 / Egrandis_v1_0.048784m)
DNA ref. Phytozome 11:   scaffold_7 (37347118..37345714)
Protein sequence: Egr1CysPrx03 (Eucgr.G02036 / Egrandis_v1_0.048784m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   220
PWM (Da):   %s   24227.5  
PI (pH):   %s   8.09
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPGLTLGDTVPDLAVETTHGKMKLHDYIGGAWTVLFSHPGDFTPVCTTELGKMAAYAPEFERRGVKLLGLSCDEVESHKAWIKDIEAFPGAKVTYPIIADPNREIIKQLNMVEPEEKDASGKQVPSRALHIVGPDKKIKLSFLYPASTGRNMDEVVRVLESLQRATKHKIATPCNWKPGEAVVISPSVSNEQAKEMFPQGYKTANLPSKKDYLRFTHVD*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGGGCCTGACGCTCGGCGACACCGTCCCGGACCTCGCCGTCGAGACCACCCACGGCAAGATGAAGCTCCACGACTACATCGGCGGCGCCTGGACCGTCCTCTTCTCTCACCCCGGT
AACCGTCGTCGTCGTCGTCGTCGTCGTCGTCTCTCCTTTTGCCCGACTCCGCATGTTTCGACGGCCCCGAGAAAAGGGAAGTCTTGTTCACCCACGACATCGCTTGCGCAGGGGATTTCA
CGCCGGTGTGCACGACGGAGCTCGGGAAGATGGCGGCGTACGCGCCGGAGTTCGAGCGGCGAGGGGTGAAGCTCCTGGGCTTGTCCTGCGACGAGGTCGAGTCGCACAAGGCGTGGATCA
AGGACATAGAGGCCTTCACT
GTCAGCTACTCTTCTCCCTATTAAACCTTTTTTTTATCACTTGGCATATGTGTGTTTGCATGTCTTGTAGGAACTTGCTTTTTTGGATTTTGATGTTGTG
TTTTATCTGGTTTTGGTGATAGTATCCTTCAGAAAGAAAAAGAAAGAGAACTTATAGGAATGTGTAGTATTATGATTTAGTAGAGTTTGCATGTCTTGTAGGAACTTGCTTTTTTGGATT
TTGATGTTGTGTTTTATCTGGTTTTGGTGATAGTATCCTTCAGAAAGAAAAAGAAAGAGAACTTATAGGAATGTGTAGTATTATGATTTAGTAGAGTGACCAAGGGAAGTCTCCTTAATC
TTAGGCACAATTTGGGTAGAATGAGGTGGTTTAATTGCGGGTCACAGGGCTGACTGTTCTGTTTCACATTTGAGATTAGGACCTTTGGCTTTTGTGCAACTTTCATTATTCCAATTTCGA
GCCAACATCCTCAATGTCGTGTTATTTGGTGGGGGTGTAGCCTGGTGCTAAGGTGACGTACCCGATAATCGCCGACCCGAATAGAGAGATAATCAAACAGCTCAACATGGTCGAGCCCGA
GGAGAAAGACGCCTCGGGGAAGCAAGTCCCTTCTAGAGCTCTGCACATTGTCGGTCCTGATAAGAAG
GTATACGTGCTCCTCTTAACTTTTCTATTCCGTGTTAATCAAACTTTTATCGG
ATGAAACAAATTGCATAAACCAATGTCATCTCATGCATGTCGTTTTCGGTTTCACGATATAACATAAATTGTATAGATCAAGCTGAGTTTTCTGTACCCGGCGAGCACGGGGAGGAACAT
GGACGAGGTGGTGAGGGTGCTGGAATCCCTGCAGAGGGCGACGAAGCACAAGATCGCCACCCCGTGCAACTGGAAGCCGGGGGAGGCGGTTGTCATCTCACCGTCCGTCTCCAACGAGCA
GGCCAAGGAGATGTTCCCGCAGGGCTACAAGACCGCCAATCTCCCGTCCAAGAAGGATTACCTCCGCTTCACTCATGTTGATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGGGCCTGACGCTCGGCGACACCGTCCCGGACCTCGCCGTCGAGACCACCCACGGCAAGATGAAGCTCCACGACTACATCGGCGGCGCCTGGACCGTCCTCTTCTCTCACCCCGGG
GATTTCACGCCGGTGTGCACGACGGAGCTCGGGAAGATGGCGGCGTACGCGCCGGAGTTCGAGCGGCGAGGGGTGAAGCTCCTGGGCTTGTCCTGCGACGAGGTCGAGTCGCACAAGGCG
TGGATCAAGGACATAGAGGCCTTCACT
CCTGGTGCTAAGGTGACGTACCCGATAATCGCCGACCCGAATAGAGAGATAATCAAACAGCTCAACATGGTCGAGCCCGAGGAGAAAGACGCC
TCGGGGAAGCAAGTCCCTTCTAGAGCTCTGCACATTGTCGGTCCTGATAAGAAG
ATCAAGCTGAGTTTTCTGTACCCGGCGAGCACGGGGAGGAACATGGACGAGGTGGTGAGGGTGCTG
GAATCCCTGCAGAGGGCGACGAAGCACAAGATCGCCACCCCGTGCAACTGGAAGCCGGGGGAGGCGGTTGTCATCTCACCGTCCGTCTCCAACGAGCAGGCCAAGGAGATGTTCCCGCAG
GGCTACAAGACCGCCAATCTCCCGTCCAAGAAGGATTACCTCCGCTTCACTCATGTTGATTAG

Retrieve as FASTA