Entry information : EgrKat01-2 ( Eucgr.F01776 / Egrandis_v1_0.010365m)
Entry ID 10159
Creation 2012-01-25 (Qiang Li)
Last sequence changes 2012-01-25 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-25 (Christophe Dunand)
Peroxidase information: EgrKat01-2 ( Eucgr.F01776 / Egrandis_v1_0.010365m)
Name (synonym) EgrKat01-2 ( Eucgr.F01776 / Egrandis_v1_0.010365m)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrKat01-2
start..stop
S start..stop
EglKat01-2 1019 0 5..492 3..490
EguKat01 1016 0 1..492 1..492
EgrKat01-1 1005 0 1..492 1..492
EglKat01-1 995 0 5..492 1..488
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 23080345..23080359 15 N° 2 23080665..23080761 97 N° 3 23081761..23082038 278 N° 4 23083002..23083778 777
N° 5 23083989..23084078 90 N° 6 23084602..23084669 68 N° 7 23084747..23084840 94 N° 8 23084929..23084988 60
join(23080345..23080359,23080665..23080761,23081761..23082038,23083002..23083778 ,23083989..23084078,23084602..23084669,23084747..23084840,23084929..23084988)


exon

Literature and cross-references EgrKat01-2 ( Eucgr.F01776 / Egrandis_v1_0.010365m)
DNA ref. Phytozome 12:   scaffold_6 (23080345..23084988)
Protein sequence: EgrKat01-2 ( Eucgr.F01776 / Egrandis_v1_0.010365m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   57019.53  
PI (pH):   %s   7.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKYRPSSAYDSSFWTTNYGAPVWNNDSSLTVGTRGPILLEDYHLIEKLANFERERIPERVVHARGASAKGFFEVTHDISHLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTRGNFDLVGNNFPVFFVRDAMKFPDAIHAFKPNPKSNIQEMWRIIDFFSHQPESLSTFAWFFDDVGIPQDYRHMEGFGVHAFTFINKTGKTNYVKFHWKPTCGVKCLLEEEAIRIGGSNHSHATKDLYDSIAAGNYPEWKLYIQVMDPALEDSFDFDPLDMTKEWPEDILPLQPVGRLVLNKNVDNFFAENEQLAFNPAFVVPGIYYSNDKLLQARIFAYSDTHRYRLGPNYLQLPVNAPKCAHHNNHHDGFMNIMHRDEEINYFPSKFDPVRHAERYPIPSQIVTGKREKVIIEKENNFKQPGERYRSWAPDRQERFINRWIKALTEPRVTHEHRSIWISYWTADKSLGQKLASRLSARPSM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (scaffold_6, 7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCGTACAAGGTACCGATCGCTTCATCTTCTCCGCTTCGACTGTCGATCTTTCTTCCATCTTCGCCAGCGGCAGAAATTATCTTTCCCTTTTTCGATCTCCGATCCGTTGATCAT
ATACTGTATTTACGTTAATGGAACCGAGATCTCCCCAGTGCTTGTTTGTTTTCGCTTCATTTCCTGTTTGGTAGAAGAAGAGCGCTCCCTGTTGGGACGTTCATGATGCTACGGCTCTGT
TTCGTCGATTTATCTCATCGCCGGCATGCCGACTTTGCAAAATGCTGATGTGTTTTTGCTGCTAAACGTGGATGTCGCAGTATCGCCCGTCCAGCGCTTACGATTCCAGCTTTTGGACAA
CCAACTACGGTGCTCCCGTCTGGAACAATGACTCATCGCTGACTGTTGGAACTAGAG
GTAGTATCGCCATTACGGATCTCTGAGTTGTTTTCTTTATCGAAAATAATGATAATTCGATGC
TCATCGTGCATGCGTAGATAGTGCTTGCACTCGAACCGGAATATTTTTACGTTGCCTTTCTGTTTTGCTTCATGCGTGTGATTAATACGTGGTTTGTGGTTTTTTATTCTTGATATAATC
ATTTGAGCACGTTCTTATAAAAAAAAACGTGCACGAGGCTCTCGACTGCATCAATGGGTTCTTTTTATTTTTGTGTTTTGGTGAGTTCGAGGTGTGTACACGCCTTCAACGAATCTAAAC
TTTTAGGTTTTGTAACAGTTTAAGGGAAAAAGCCACCAAGAAGGGAAAACTATGCCCACTAAGACATATTTATTCACAAAATATTTTCTTGTGACACCAAAAATCCAAAATGTAAACATG
TATGACATATTTACTTACACGGACTGTTAAAACTCTGACTACATAGACTTCAAAAAGCAAACGGAGTCACCTAACTTAAGTGAAATTAACTAAAACATCATATGATAGAACTTTGATGGA
AAGTAAATGTATCATATATACACAAGTTCGATATTTTTATGTCACAAGAAAAAGATTAGATAAATATATATAGTTTGAGATTTTTCATATCACAAAAAAAAACTCGGGCTTAATATGTTG
CAATGGACATAAAGGTTTTTATAGTTTTTTTTCTCGATATTAAAGTATAACTCTACAATTTTTCACTTTTTGTGTTCTTCAGCAACTTGTGACAGGAAGGAAAAATATCGTAGTTCTCTT
TTTTTGATAATCTAGAGGCAGGCACGATTGTGGAAACTCGACCCCTAGGCCTTTTTGGGCCGTGAGGGGACCCTGACCCACAGCAGAAGAACCTTGTAGTGATATTAGCTGGTCGCAGGA
GTATCCTTTTTGGCTCTACTTGTGCTCTACGCGGACATCGTAGTGAAGACACGGAGCTTAACCGTCATCTAAAAGGAGATTTCTTTCATTTTACAGGTCCGATTCTCCTGGAGGACTACC
ATCTGATTGAGAAACTTGCCAACTTCGAGAGAGAGAGGATTCCTGAGCGAGTGGTCCATGCACGGGGAGCCAGCGCGAAAGGGTTCTTCGAGGTCACCCACGACATCTCTCACTTGACCT
GTGCTGATTTCCTCCGGGCTCCTGGAGTCCAGACGCCCGTCATCGTCCGTTTCTCCACCGTCATCCACGAGCGCGGCAGCCCCGAAACCCTCAGGGACCCTCGTGGTTTTGCAGTGAAGT
TCTACACCAGAGAG
GTAACGAGATGATCACAAGCCTTGAAATCTGCAAATTCCATGTTCTTCGGCTTTTTTATTATTATGATTGCTTGGAACGTGTATCTGTTTAACTGACTATGCAGGC
ACTGTGCTTGGCTTTTGTGATTCGGGCAGCGTCTTTGTGCGCGTATGCTCTAAAGCCCGTGCCGAATAGCCACGTGATGATGGATTTTATTTTGACACTTTGACATGACTAGTTGACGAT
AACCTTACCGGAGGGCTGTAAAACAAAGAGCTTATTTTAAGGAATAATGTAACCTAGATCGCTTACTTGAGTACCATAAATTTTTTTCTAATCACCTAAATATCATAATTTTTATAAATA
AAAAAATAGTATATTATGACTTTTTTTATCACTTAAAGGCCATTATTTCTATTAAACAAAATGTTTATTATAGCATCATAAATTTCAATCAATTACTTAAGTGCTAAAATATTTTTAAAA
CATGTACTTAGATGCCAAAGATCTAACGTGGCATTGCACTTAAGATGAATGTTTTAAAAAATATAATGTCACTTAAGTGATCGAAAAAAAAAAGTTATATCACTTAACTAGGCATCATAT
GTAAATAATAGTATTTAAGTGATAAAAAAAATTATGATTTTTAAGTAAACGCCACACAAAATCACGGTACTTATAATGTTCTTCTTTTATTTAAAATAAAAGAGAAAGCTGAACATCATA
ATACAAACAAGTAGTCTCTCCACATAATTGTATTGTCTCACGTTTCTCTTCTTTTCTTTGATAATTTTTATTTCGACACTTCGATGTGACTAGTTGAAGATGAATTTTTATCGAAGGGCT
GTAATAGAGAGGTCCATTTCAAGTAAGAGAGAAGTCGAGACATCAAAACATGAGTAGTATCTCTTCACGTAATTGCGCTGTTTCGCGCTTCTCTTCTTTCCTCCTTTCACCATTCGTTTT
TTTTCTTCTGAACGCAGGGAAACTTTGATCTGGTGGGGAACAATTTCCCAGTCTTCTTCGTTCGCGATGCAATGAAATTCCCGGACGCGATCCATGCGTTCAAGCCGAACCCGAAGTCTA
ACATCCAGGAGATGTGGAGAATCATCGATTTCTTCTCCCACCAGCCCGAGAGTCTGTCCACGTTCGCGTGGTTCTTCGATGATGTGGGCATTCCTCAGGACTACAGGCACATGGAGGGAT
TCGGTGTGCACGCTTTCACCTTCATCAACAAGACCGGAAAGACGAATTACGTGAAATTCCACTGGAAGCCAACTTGCGGGGTGAAGTGCTTGCTGGAGGAGGAGGCGATCCGCATTGGAG
GATCGAACCACAGCCATGCGACCAAGGATCTTTATGACTCGATCGCTGCTGGCAACTACCCGGAGTGGAAGCTCTACATCCAAGTGATGGATCCTGCTCTTGAAGACAGCTTCGACTTCG
ATCCGCTGGATATGACGAAGGAATGGCCTGAGGACATCTTGCCTCTGCAACCAGTAGGCCGCTTGGTGCTGAACAAAAACGTCGATAACTTCTTCGCTGAGAATGAGCAGCTAGCGTTTA
ACCCAGCATTTGTGGTCCCTGGCATCTATTACTCCAATGATAAGCTTCTCCAAGCTAGGATTTTCGCCTATTCTGATACTCACCGATATCGCCTTGGACCAAACTACCTTCAACTCCCCG
TTAATGCTCCCAAGTGCGCTCATCACAACAACCACCATGATGGTTTCATGAATATCATGCACAGGGATGAAGAG
GTAATGATCTTTATTTTTCTGTTTGCTCGATAACGGCGCTGAGAAT
GAACGTGCCTCTAGCATTACCTAATAACATGTTTTTAGCGGCTTGTACAGAGATCTGAATTGGTTATAGTAGTCTATTGATGCAACGCTCGACTTGAATCAGTTTGTTTTTTGATAAAAA
AGGAAGAACTAACGATGTCATTTATCCATGATGCTGATTTGCAGATAAATTATTTCCCTTCGAAATTTGATCCCGTTCGCCATGCAGAAAGGTACCCGATACCGTCTCAAATCGTGACTG
GAAAGCGAGAAAAG
GTCAGTTTACGGAGTCTATGCATTTATATAAAAAAACGACTCTTAAAAAACATGTTCCTGCCTCCAGGATACCAAGTAAAAGAACGGGAATTGTATGCATGGTATT
ATTAAATCTATTTTGCGTCGATGATTGAGGGGCGGGCTTGGTAAAGGTTAAAGCAGGTCGGACTCAGCAGAGAATGCCAGAAGAAATAATTACACGCTTGCGATGAAGGCCCGCCCGCGT
AACAATGGTTAATCTGTGGCAAGTCGAAGGGCAATGCGGCAGTGGTGCTTCTGTTTGGACCTTAGATAAAATTGATGTAATTCAACTTCTGGTGTGCCGTTGCGATGATTACGGTGCTAT
GATCGTTGGCTTTTACAGACTAAGTTAAGAACTTACAAATGAGGAAGGGAATAAGTTAAAACTACAGAAGAGAAGTCGATGTTTTCGTGGCTTGAAAATGTAGTTCTTGGGGTTCGCCTT
GGATTGGATATCTGTGCTGCTAGTATTAATCTGTATGTGAACTCACTGGTTATGCAGGTCATTATTGAGAAGGAGAACAACTTCAAGCAGCCAGGAGAGAGATACCGATCCTGGGCGCCG
GACAG
GTACCTTTTGACCACTGTCTCCTGAGTCGATGTGCAATTTACTTGGTCACTCAATTGTCTTTCGACTTTGTCGCCAGGCAAGAGCGTTTCATTAACCGCTGGATCAAGGCATTGA
CTGAACCCCGTGTCACCCACGAGCATCGCTCCATCTGGATCTCTTACTGGACTCAG
GTGAGCTATCACTATTCGCCCGGTTTGCTTCCTTTCATGGTACCGAAATTTGTTTATACTGATG
GCCCATGACGCATCTTCACTGCAGGCTGACAAATCGCTCGGCCAGAAGCTTGCTTCCCGCCTCAGCGCACGACCGAGCATGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCGTACAAGTATCGCCCGTCCAGCGCTTACGATTCCAGCTTTTGGACAACCAACTACGGTGCTCCCGTCTGGAACAATGACTCATCGCTGACTGTTGGAACTAGAGGTCCGATT
CTCCTGGAGGACTACCATCTGATTGAGAAACTTGCCAACTTCGAGAGAGAGAGGATTCCTGAGCGAGTGGTCCATGCACGGGGAGCCAGCGCGAAAGGGTTCTTCGAGGTCACCCACGAC
ATCTCTCACTTGACCTGTGCTGATTTCCTCCGGGCTCCTGGAGTCCAGACGCCCGTCATCGTCCGTTTCTCCACCGTCATCCACGAGCGCGGCAGCCCCGAAACCCTCAGGGACCCTCGT
GGTTTTGCAGTGAAGTTCTACACCAGAGAG
GGAAACTTTGATCTGGTGGGGAACAATTTCCCAGTCTTCTTCGTTCGCGATGCAATGAAATTCCCGGACGCGATCCATGCGTTCAAGCCG
AACCCGAAGTCTAACATCCAGGAGATGTGGAGAATCATCGATTTCTTCTCCCACCAGCCCGAGAGTCTGTCCACGTTCGCGTGGTTCTTCGATGATGTGGGCATTCCTCAGGACTACAGG
CACATGGAGGGATTCGGTGTGCACGCTTTCACCTTCATCAACAAGACCGGAAAGACGAATTACGTGAAATTCCACTGGAAGCCAACTTGCGGGGTGAAGTGCTTGCTGGAGGAGGAGGCG
ATCCGCATTGGAGGATCGAACCACAGCCATGCGACCAAGGATCTTTATGACTCGATCGCTGCTGGCAACTACCCGGAGTGGAAGCTCTACATCCAAGTGATGGATCCTGCTCTTGAAGAC
AGCTTCGACTTCGATCCGCTGGATATGACGAAGGAATGGCCTGAGGACATCTTGCCTCTGCAACCAGTAGGCCGCTTGGTGCTGAACAAAAACGTCGATAACTTCTTCGCTGAGAATGAG
CAGCTAGCGTTTAACCCAGCATTTGTGGTCCCTGGCATCTATTACTCCAATGATAAGCTTCTCCAAGCTAGGATTTTCGCCTATTCTGATACTCACCGATATCGCCTTGGACCAAACTAC
CTTCAACTCCCCGTTAATGCTCCCAAGTGCGCTCATCACAACAACCACCATGATGGTTTCATGAATATCATGCACAGGGATGAAGAG
ATAAATTATTTCCCTTCGAAATTTGATCCCGTT
CGCCATGCAGAAAGGTACCCGATACCGTCTCAAATCGTGACTGGAAAGCGAGAAAAG
GTCATTATTGAGAAGGAGAACAACTTCAAGCAGCCAGGAGAGAGATACCGATCCTGGGCGCCG
GACAG
GCAAGAGCGTTTCATTAACCGCTGGATCAAGGCATTGACTGAACCCCGTGTCACCCACGAGCATCGCTCCATCTGGATCTCTTACTGGACTCAGGCTGACAAATCGCTCGGCCAG
AAGCTTGCTTCCCGCCTCAGCGCACGACCGAGCATGTAA

Retrieve as FASTA