Entry information : EgrGPx03 ( Eucgr.C02602 / Egrandis_v1_0.024391m)
Entry ID 10164
Creation 2012-01-25 (Qiang Li)
Last sequence changes 2012-01-25 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-22 (Christophe Dunand)
Peroxidase information: EgrGPx03 ( Eucgr.C02602 / Egrandis_v1_0.024391m)
Name (synonym) EgrGPx03 ( Eucgr.C02602 / Egrandis_v1_0.024391m)
Class Plant glutathione peroxidase    [Orthogroup: Gpx2001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrGPx03
start..stop
S start..stop
EguGPx03 448 1e-162 1..247 1..247
EglGPx03 388 6e-139 1..238 1..218
VvGPx01 363 6e-129 1..247 1..246
CsGPx01 347 1e-122 3..247 5..245
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 49571813..49572100 288 N° 2 49571164..49571240 77 N° 3 49571022..49571083 62 N° 4 49569706..49569824 119
N° 5 49569455..49569622 168 N° 6 49569000..49569029 30  
complement(join(49569000..49569029,49569455..49569622,49569706..49569824,4957102 2..49571083,49571164..49571240,49571813..49572100))


exon

Literature and cross-references EgrGPx03 ( Eucgr.C02602 / Egrandis_v1_0.024391m)
DNA ref. Phytozome 11:   scaffold_3 (49572100..49569000)
Protein sequence: EgrGPx03 ( Eucgr.C02602 / Egrandis_v1_0.024391m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   247
PWM (Da):   %s   26838.7  
PI (pH):   %s   10
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASAPFSAAFSAPSYGFRRARTNGNSPFPTSLWSPAALRVPSSVRSSLGSCNSAFLVNGLSSSSLPSSSRLSFSSRSSGVYARAATEKTLYDFSVKDIDRNDVSLSKFKGKVLLIVNVASKCGLTTSNYKELSHVYEKYKTGFEILAFPCNQFGGQEPGSNPEIKQFACTRFKAEFPIFDVDVNGPGTAPVYQFLKSSAGGFLGELVKWNFEKFLVDKNGKVVERYPPTTSPFQIEKDIQKLLAA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (scaffold_3, 5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCGGCCCCTTTTTCGGCCGCTTTCTCCGCCCCTTCGTACGGCTTCCGTCGAGCCAGAACGAATGGAAACTCCCCCTTTCCGACCTCCCTTTGGTCGCCGGCCGCTCTTCGCGTG
CCGTCATCGGTTCGATCCTCGCTCGGTTCGTGTAATTCGGCTTTTCTCGTTAATGGGTTGTCGTCGTCGTCCCTTCCGAGTTCGTCGCGGCTCAGCTTCAGTTCTCGCTCGTCGGGTGTT
TATGCTAGAGCTGCCACTGAGAAGACCCTCTACGATTTCAGCGTGAAG
GTATCGAATTTCTCTTCTGGGTGTAGCTGAAATTGGTATTTGGAGAGATCTTCTTTTTTGGGTCGTCAGGGA
ACTTTGTAATTCACTTAGATACGGTGTTTTTATGTATTTATTTATCTTCGGTAGAATCAATCAATTCTGATGGCTTGCCCAAGCTACTTTGGAAATTAGAAAAAAAATATATCTTAATTG
TCTCAGCCGCCACACTGTTTTTTGCATCTTCTCTGTTTTATTGTTACTTTTGGATGACGAGGAAGCACATTTTAGCTACTTAACATTGGTGCTTCCAATTTGGACTAAAAGAAATCAAGC
TGGAGTTGAGGTCGCTTATTTGCTCTTTGTTCATGAATTGAACTAATTTGCAAATTCTCCACGGTATGCAAATCCTTAGAATTAAGATTCATGCTGTTGTGGCTAAAAATTCTTCGTTGT
TTTGGCACCTGCTATGTTTCGGTAATTTATGTGGACATTATTATACTATTCATTTTTCGGTTTACATACTGAATTTTGGGTAAAGCTGCTTTATTCATGATAATTGCTAATTGCTGCACA
CATTTTTCTTCATGGTTCAGGACATTGATAGGAATGATGTTTCATTGAGCAAATTCAAGGGAAAAGTCTTATTAATTGTGAACGTAGCTTCGAAATGGTAATTGCTTTATCTCCTTCAGT
TGTCTGATTTAATTTATCAGATTCACAGTCTCATTGAAGAATTTTCTTGTGATTCAGTGGTTTAACGACATCAAACTACAAGGAGCTCTCGCACGTATATGAGAAGTACAAGACTCAAGG
TGAGATGAGATTGTGGGGAGAGTTATAGAATTCCTTAAAAGCTTCTCCTGTTTGAAGTTAGACTACTATCTTTGAGCTAGGAGGGATCATTAATTTTTAAATATAGTAGATGAAATCATG
ATTCAGCAAAGGATGTGAATCACCTTATTATATCAGTGTCTTTTTCCAATCATCGGAAAATGTACAATATCAATGGAGTTTTGTCTGTCCTACACGCCAAAAGATTCAAGTGGAAGTTCT
GTTCAAGTTCTCAAGACCATCTAATTAGGAGCTGAATTTCCCTTAACAACAAGTCACGTCGATCATTATGCTTCTCACTTATAGTTTTTTTAATGATATGGGCTCCAACCAAAATTTAAT
CTTCTCAAGCAAGCTTTGTTTAGTTTGCCCTGTGGTACTGGGTCTTACAGAGATTGCTAAAGGGATTGTCCAATGGTCTTTGCTGCGGTTGAGTGTAACAGTGTGCTAGAAATCAGTTGT
CCTTTATTTTTCCGTGGGACTTTTATCAGTGTTTTTTCCAGTCCATTTTCAGGTGTTATATTTTGCCAATGATGTTTGTTACATCTTCTTTTTGGTACTCTTGCACATTTACGAAGGGCA
CAGTTAGAGATGCTTCCTTTGTGTGTGTGTGTACGAGGGAGAGAGAGAGAGAGAGTAGTATATCCTGGATGGATGGATGAATGGATGGGGTGATAGGGGTAGAGAAAGAGAGATGTACCT
CCACTGATGAAAAGGAAGGGTTCTTTGTTTGGATGCAAGGAGAGAGACATAGAGAGGGAGAGGCCTATTGCCTCTACCGCAAGGGTGGGATGGCTGTTTCTTTGCTGGGATGGAAACAGT
GGGAGACCTCCACTGATGAAAGGAAAGGAGTTTTTTTTTTTTTTTTTTTTTGGTGGGGGGGGGGGGGGGGAGCTATATATTTTGCTATATCCAAGAGACAGGAAGAGATCCACTTCTTAG
AGAGTGAAATAAGTTCTTTGCTTTGATTCAAGGAGAGAGCTATAGAGAGGGAGAGACCTATTGCCTCTACTGGAAGGGTGGGATGGCTGTTTCTTTGCTGGGATGGAAAGAGTGGGAGAC
CTCTTTCCTCTGATATAATGTATAGCTTGAATCTTCTATGCAGATTTGGATTTGGTTAGTCCTCTTTCTATATCTTTAAAATTGATAAGAAACACCTTGGGCTGTCCATGTTACAGGTTT
TGAAATTCTGGCTTTTCCTTGTAATCAATTTGGTGGCCAGGAGCCTGGTTCAAATCCTGAGATTAAACAATTTGCTTGTACAAGGTTTAAAGCAGAGTTTCCGATTTTTGATAAG
GTTTG
ACTTCCACACATACGTTCTTTCCTCTATTTTAAGTGATGGCTGGAATGAACAACTGAGCTCAAGTCTGTTGGAAACAGGTTGATGTTAATGGACCAGGTACAGCTCCTGTGTATCAGTTT
CTGAAATCGAGTGCAGGAGGTTTTTTGGGTGAACTGGTCAAGTGGAACTTTGAGAAATTTCTGGTTGACAAAAATGGCAAAGTTGTGGAGAGATATCCTCCAACAACGTCTCCTTTTCAA
ATAGAG
GTACGTTTTTTAAGCTAACTTGTGAAGTTCGGAGATATGCCTAAGTAATCGATGTTCTGAAGTATGGCAATTGCTTGCTATCATGACTGCATGGAGATGGTTACGGTCTTGTAT
GTTGTGTGACTGTATATCCGGTGTGCTTTTGTAATCGTTCACCATGCCGTTCCCATAGAAAAAGCTGGTCCCTATTCTTTCCCTTTCTGAGGCAGAGTTTTGTATGTTCATTGTAACTTC
AGTGTGTTCTCAATGCACTAATTCCCCTGGGTCACCGACAATAATAAGTTTTTACACCTCCCATTCACCAGAAAGGAGGTCTATATGTCACGTTCAATAATTCTAGAAGAAAAGACCAAC
AAAAGACTATCTTCAAGCCTCAGAATGATTTGAGAAGTTCTTTCGATTAACATTCTCGAGTCTTCTTGCAGAAGGACATTCAGAAGCTTCTTGCTGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCGGCCCCTTTTTCGGCCGCTTTCTCCGCCCCTTCGTACGGCTTCCGTCGAGCCAGAACGAATGGAAACTCCCCCTTTCCGACCTCCCTTTGGTCGCCGGCCGCTCTTCGCGTG
CCGTCATCGGTTCGATCCTCGCTCGGTTCGTGTAATTCGGCTTTTCTCGTTAATGGGTTGTCGTCGTCGTCCCTTCCGAGTTCGTCGCGGCTCAGCTTCAGTTCTCGCTCGTCGGGTGTT
TATGCTAGAGCTGCCACTGAGAAGACCCTCTACGATTTCAGCGTGAAG
GACATTGATAGGAATGATGTTTCATTGAGCAAATTCAAGGGAAAAGTCTTATTAATTGTGAACGTAGCTTCG
AAATG
TGGTTTAACGACATCAAACTACAAGGAGCTCTCGCACGTATATGAGAAGTACAAGACTCAAGGTTTTGAAATTCTGGCTTTTCCTTGTAATCAATTTGGTGGCCAGGAGCCTGGT
TCAAATCCTGAGATTAAACAATTTGCTTGTACAAGGTTTAAAGCAGAGTTTCCGATTTTTGATAAG
GTTGATGTTAATGGACCAGGTACAGCTCCTGTGTATCAGTTTCTGAAATCGAGT
GCAGGAGGTTTTTTGGGTGAACTGGTCAAGTGGAACTTTGAGAAATTTCTGGTTGACAAAAATGGCAAAGTTGTGGAGAGATATCCTCCAACAACGTCTCCTTTTCAAATAGAG
AAGGAC
ATTCAGAAGCTTCTTGCTGCTTGA

Retrieve as FASTA