Entry information : EgrGPx02 ( Eucgr.A00257 / Egrandis_v1_0.027185m)
Entry ID 10166
Creation 2012-01-25 (Qiang Li)
Last sequence changes 2012-01-25 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-25 (Christophe Dunand)
Peroxidase information: EgrGPx02 ( Eucgr.A00257 / Egrandis_v1_0.027185m)
Name (synonym) EgrGPx02 ( Eucgr.A00257 / Egrandis_v1_0.027185m)
Class Plant glutathione peroxidase    [Orthogroup: Gpx2001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrGPx02
start..stop
S start..stop
EglGPx01 407 8e-148 1..202 1..202
EguGPx01 405 7e-147 1..202 1..202
EgrGPx01 396 3e-143 1..196 1..196
EcamGPx01 388 3e-140 1..192 1..192
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3186743..3186892 150 N° 2 3187625..3187701 77 N° 3 3188113..3188174 62 N° 4 3188281..3188399 119
N° 5 3188747..3188914 168 N° 6 3188991..3189023 33  
join(3186743..3186892,3187625..3187701,3188113..3188174,3188281..3188399,3188747 ..3188914,3188991..3189023)


exon

Literature and cross-references EgrGPx02 ( Eucgr.A00257 / Egrandis_v1_0.027185m)
DNA ref. Phytozome 11:   scaffold_1 (3186743..3189023)
EST ref. GenBank:   JK648851.1
Cluster/Prediction ref. Genebank:   104445716
Protein sequence: EgrGPx02 ( Eucgr.A00257 / Egrandis_v1_0.027185m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   202 (176)
PWM (Da):   %s   22714.61 (19649.0) Transmb domain:   %s   i7-26o
PI (pH):   %s   8.01 (7.19) Peptide Signal:   %s   cut: 27 range:27-202
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQWFKSPSFFPFLFALLALSVYLFNAHRPASRAPEMAEESSKSIYDFTVKDIRGNDVSLSEYSGKVLLIVNVASKCGLTQSNYKELNTLYEKYKEGFEVLAFPCNQFAGQEPGSNEEIQETVCTMFKAEFPIFDVEVNGKNVAPLYKFLKSQKGGIFGDGIKWNFTKFLVNREGKVVERYAPTTAPLKIEKDIQNLLGSS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (scaffold_1, Egrandis_v1_0.027185m) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGTGGTTCAAATCCCCCAGCTTCTTCCCATTCCTCTTCGCGCTTCTAGCTCTCTCCGTCTACTTGTTCAACGCGCATCGACCGGCGTCTCGTGCTCCGGAAATGGCCGAGGAATCG
TCTAAGTCCATCTACGATTTCACCGTCAAG
GTGCCTTTTTTTCTCCCCTTTTGAGATGTCGACTGGGATGATGGGTTGTGCGTATCCTGTTCTGTCTGCTCTTGGGTTGGAGAGGGGAGA
GGTTTTAGAGGCTGCGCTATGTGCAAGATTGGAACTTTAGCTCGCGGTCGAAGATGGGTCCTCTTTTTTTTTTTTTTTGGATGGGGGGTGGGGGAGATTTTAGCTGTCTCCATTAGCATA
CGGGCTTGATCGGATTTGAGATGGTGATTGCTTGCGCGTGCTCGGACAGAAACTAACGGCGTGGTTGAAATTCCTAAGCGAGGACAGCTCTTGCTCGGTTTGTTTGTTCCGCAGCGAGTC
GTTAACGTGTGATGTGGCCGTTCCATGGAACGCTTGTTTGTAATTCTGCTGCTTTTCTTCTGCAACTGCGAACTCACATGTTTTCTAAGCGGGTCAATGACCTGATTGTGGAAGTTAGGT
TGAGTATCGGTCAGATCATGAATCTTTTGCTTGATCACAGTTTCTTAGTCAATCCGTAATTTGCCTTGAATCCTAAAACCAACGATTTGAATCTTGTTCGGTCTTCTTTCAACTTGATAC
GGATCCCTGTTTGTACGTTCTTTTCTGCGGAAGAGTGGACTGGATATACCATATTTTGCTTCTTATGTTGTAAAAGTTTATTTGATGTAGATTCCCTTTTCATGGTTTTTATAGTTAGAG
ATATTTATGACTGTAGATGTCAATTATCTGATGCATATGCAGGACATTCGTGGAAATGATGTAAGTTTGAGCGAGTACTCTGGGAAGGTTCTTCTGATTGTCAACGTTGCTTCAAAATGG
TATTGCCACTGAATGTGCCTTCTCTTCAAGAATTGTGTTTCTTTGATCAGAACCTCGATAGGAATTCAGCAACTTAAGCGTTCATGAAATGGTTTAGTAGTTGACTAGTTGGTCCTGTTG
TATGTCGCTATATGTTTGACTGCATGCAGAACACTTGCATGTCCAATCTTGAACCTGTTATCACTCTTTGGTAGTCCAAACAGCATGAGCCTCCGTCGATCCCGTGAGCCTGGGCTGCTT
CTCTTTCCCCTTTAACGGCTACGCATAAATCTATTAACCATTTGTTCTAGATGTAATTGAGTGGCCGATTGTTAAATCCAGTTCAAGTTCCCAGTAACAGTCAACTCCTTGAACTTATAT
CATCTGCTTTGATACTTATGATATCTAATATAGCGCACACATGTTTGCAGTGGTCTCACCCAATCAAATTACAAGGAATTGAACACTTTATATGAAAAATACAAGGAGCAAGGTTTGCTC
TTTTTGGTCTTCTGTGTTTCAATTTCGTTCTCATATGTTATACTCTGCGCCATATCCTTTGGGGTTTGTATATGTTCATGACTGATATTTCTTAGCAGGATTTGAAGTACTGGCATTTCC
ATGCAATCAGTTTGCAGGACAAGAGCCAGGGAGTAATGAAGAGATTCAAGAGACTGTATGCACTATGTTCAAGGCTGAATTCCCTATTTTCGACAAG
GTAAACATGAGAAGCCAAAAACA
ATGAGAAAAAAAATTAAATGGAAGGGAATTCTTTATATTCTGATTCCTCATGCTTTTTGGTCATTTTAACTCAAGAGCACTATCAATCTCTCAGTATGCATGAAATTTGATGATTGACGA
GCTCTAGATGAGGTTGAGAATTTGCTTGCAATGTGTTTCATTTGCTCTTTCCACAATGCGACAAAAGAGACTTGTTCAATATGCAAGTTTAAGTTGCATAACCGTCTTCCTCTTTTACAA
TATTGACTCTGTACAATACGGAGAAAAGACATTTTGAGTTGATATTACACTCTATTTTCAATATTATAGTCTATTGTGCTACAGGTCGAGGTGAATGGCAAGAATGTGGCCCCACTCTAC
AAGTTTTTAAAATCTCAGAAAGGAGGGATATTTGGAGATGGCATCAAATGGAACTTTACAAAGTTTCTGGTGAACAGAGAAGGGAAAGTTGTGGAGAGATATGCTCCCACGACAGCACCT
CTTAAAATTGAG
GTTAGGGATTTGACTTACAGCAACGCAAAGGAGCAATTTAAGTCGAATCTAACTTGTTTTTTGGGTTTTCCTGCAGAAAGATATCCAAAATCTGTTGGGATCATCTTG
A

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGTGGTTCAAATCCCCCAGCTTCTTCCCATTCCTCTTCGCGCTTCTAGCTCTCTCCGTCTACTTGTTCAACGCGCATCGACCGGCGTCTCGTGCTCCGGAAATGGCCGAGGAATCG
TCTAAGTCCATCTACGATTTCACCGTCAAG
GACATTCGTGGAAATGATGTAAGTTTGAGCGAGTACTCTGGGAAGGTTCTTCTGATTGTCAACGTTGCTTCAAAATGTGGTCTCACCCAA
TCAAATTACAAGGAATTGAACACTTTATATGAAAAATACAAGGAGCAAG
GATTTGAAGTACTGGCATTTCCATGCAATCAGTTTGCAGGACAAGAGCCAGGGAGTAATGAAGAGATTCAA
GAGACTGTATGCACTATGTTCAAGGCTGAATTCCCTATTTTCGACAAG
GTCGAGGTGAATGGCAAGAATGTGGCCCCACTCTACAAGTTTTTAAAATCTCAGAAAGGAGGGATATTTGGA
GATGGCATCAAATGGAACTTTACAAAGTTTCTGGTGAACAGAGAAGGGAAAGTTGTGGAGAGATATGCTCCCACGACAGCACCTCTTAAAATTGAG
AAAGATATCCAAAATCTGTTGGGA
TCATCTTGA

Retrieve as FASTA